Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316509974:

Variant ID: vg0316509974 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16509974
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGGATAATTCATTCGATTTGCATAGTTGGAGGTGAAGAATATCCGGTTTTGTAGTTTAATGGGGTAATTCGGTCGACCGCGATAGTTCGGGGTAATTC[A/G]
TACTTTTTCCTTGATAATTTGATGTACTATTCCCATCATTGTACAGTTCTATTTTCCCTACTAATTATCAATATTGTCCGGTATCTTTTCCTACTTTAAT

Reverse complement sequence

ATTAAAGTAGGAAAAGATACCGGACAATATTGATAATTAGTAGGGAAAATAGAACTGTACAATGATGGGAATAGTACATCAAATTATCAAGGAAAAAGTA[T/C]
GAATTACCCCGAACTATCGCGGTCGACCGAATTACCCCATTAAACTACAAAACCGGATATTCTTCACCTCCAACTATGCAAATCGAATGAATTATCCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 24.10% 0.59% 12.65% NA
All Indica  2759 79.30% 15.30% 0.65% 4.75% NA
All Japonica  1512 32.80% 40.30% 0.53% 26.32% NA
Aus  269 77.30% 2.20% 0.37% 20.07% NA
Indica I  595 62.20% 37.80% 0.00% 0.00% NA
Indica II  465 92.70% 5.20% 0.43% 1.72% NA
Indica III  913 84.30% 8.20% 0.33% 7.12% NA
Indica Intermediate  786 78.60% 12.30% 1.65% 7.38% NA
Temperate Japonica  767 6.80% 51.10% 0.65% 41.46% NA
Tropical Japonica  504 66.10% 25.80% 0.40% 7.74% NA
Japonica Intermediate  241 46.10% 36.50% 0.41% 17.01% NA
VI/Aromatic  96 12.50% 83.30% 0.00% 4.17% NA
Intermediate  90 64.40% 22.20% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316509974 A -> DEL N N silent_mutation Average:68.294; most accessible tissue: Callus, score: 82.312 N N N N
vg0316509974 A -> G LOC_Os03g29065.1 upstream_gene_variant ; 2700.0bp to feature; MODIFIER silent_mutation Average:68.294; most accessible tissue: Callus, score: 82.312 N N N N
vg0316509974 A -> G LOC_Os03g29045.1 downstream_gene_variant ; 4907.0bp to feature; MODIFIER silent_mutation Average:68.294; most accessible tissue: Callus, score: 82.312 N N N N
vg0316509974 A -> G LOC_Os03g29045-LOC_Os03g29065 intergenic_region ; MODIFIER silent_mutation Average:68.294; most accessible tissue: Callus, score: 82.312 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316509974 NA 7.48E-06 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 NA 3.39E-06 mr1049_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 NA 2.73E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 NA 5.03E-07 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 2.66E-06 2.66E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 5.81E-06 5.80E-06 mr1719_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 NA 6.40E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 NA 6.69E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 NA 1.08E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 3.26E-06 3.26E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 8.19E-06 8.19E-06 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316509974 2.07E-06 2.07E-06 mr1981_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251