Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316507291:

Variant ID: vg0316507291 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16507291
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.36, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGTACTCATCGAGCTTGTGAGTTGTGACAGCGAGGGAGTATGGAGTGAGTAGGAGTACGTAGTACTACATCCTATTATAAGTGCAACTACTCCCACCATC[T/C]
CATAATATAATGAATTTTGATTTTTTTTACTTGTACTGTTTGACCATTCATCTTATTTAATTTTTTTTGAAATTATTATTTATTTTATTTGTGACTTACT

Reverse complement sequence

AGTAAGTCACAAATAAAATAAATAATAATTTCAAAAAAAATTAAATAAGATGAATGGTCAAACAGTACAAGTAAAAAAAATCAAAATTCATTATATTATG[A/G]
GATGGTGGGAGTAGTTGCACTTATAATAGGATGTAGTACTACGTACTCCTACTCACTCCATACTCCCTCGCTGTCACAACTCACAAGCTCGATGAGTACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 17.30% 0.42% 19.68% NA
All Indica  2759 78.50% 5.20% 0.43% 15.80% NA
All Japonica  1512 41.10% 31.00% 0.46% 27.38% NA
Aus  269 13.00% 65.40% 0.00% 21.56% NA
Indica I  595 92.80% 2.40% 0.50% 4.37% NA
Indica II  465 74.60% 0.20% 0.65% 24.52% NA
Indica III  913 75.80% 8.80% 0.22% 15.22% NA
Indica Intermediate  786 73.30% 6.20% 0.51% 19.97% NA
Temperate Japonica  767 51.60% 4.80% 0.65% 42.89% NA
Tropical Japonica  504 26.80% 64.30% 0.40% 8.53% NA
Japonica Intermediate  241 37.80% 44.80% 0.00% 17.43% NA
VI/Aromatic  96 88.50% 7.30% 0.00% 4.17% NA
Intermediate  90 56.70% 22.20% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316507291 T -> C LOC_Os03g29045.1 downstream_gene_variant ; 2224.0bp to feature; MODIFIER silent_mutation Average:72.134; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N
vg0316507291 T -> C LOC_Os03g29045-LOC_Os03g29065 intergenic_region ; MODIFIER silent_mutation Average:72.134; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N
vg0316507291 T -> DEL N N silent_mutation Average:72.134; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316507291 T C -0.01 0.0 0.01 0.0 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316507291 NA 8.60E-09 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 9.91E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 4.17E-07 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 5.25E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 8.40E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 2.21E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 4.80E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 6.07E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 1.81E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 1.53E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 1.06E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 1.61E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 8.02E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 3.38E-06 3.38E-06 mr1372_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 2.02E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 4.07E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 1.94E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 5.54E-06 mr1546_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 2.08E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 1.39E-07 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 7.36E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 3.76E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 5.56E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 7.63E-09 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 8.21E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 3.55E-07 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 8.79E-08 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 4.76E-08 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 6.03E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 5.12E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 4.10E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 1.66E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 5.89E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 6.93E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316507291 NA 7.38E-06 mr1912_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251