\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316506170:

Variant ID: vg0316506170 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16506170
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCAGGATCAAATACCATCGAGGATCTCCTTTGCACTGGTTTTGTAAGTTGGGGATGTATTGTATCCGGTTTTTCGGTTCAGGGATAAAAATCAGACT[A/G]
GACGACAAATGGAGGGACCTAGAGTGAACTTATTCCTTTAGGGAAATCAATGTATGGGCCTTTAGAAGGCCTTAAGAATTCGTTCATGGTTGTTATTAGG

Reverse complement sequence

CCTAATAACAACCATGAACGAATTCTTAAGGCCTTCTAAAGGCCCATACATTGATTTCCCTAAAGGAATAAGTTCACTCTAGGTCCCTCCATTTGTCGTC[T/C]
AGTCTGATTTTTATCCCTGAACCGAAAAACCGGATACAATACATCCCCAACTTACAAAACCAGTGCAAAGGAGATCCTCGATGGTATTTGATCCTGGTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 24.00% 0.13% 13.37% NA
All Indica  2759 79.20% 15.30% 0.07% 5.36% NA
All Japonica  1512 32.50% 40.20% 0.13% 27.12% NA
Aus  269 76.60% 1.10% 0.74% 21.56% NA
Indica I  595 62.20% 37.80% 0.00% 0.00% NA
Indica II  465 92.00% 5.60% 0.00% 2.37% NA
Indica III  913 84.20% 8.30% 0.00% 7.45% NA
Indica Intermediate  786 78.80% 12.20% 0.25% 8.78% NA
Temperate Japonica  767 6.40% 50.80% 0.26% 42.50% NA
Tropical Japonica  504 65.90% 25.80% 0.00% 8.33% NA
Japonica Intermediate  241 46.10% 36.50% 0.00% 17.43% NA
VI/Aromatic  96 12.50% 83.30% 0.00% 4.17% NA
Intermediate  90 64.40% 22.20% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316506170 A -> DEL N N silent_mutation Average:82.965; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N
vg0316506170 A -> G LOC_Os03g29045.1 downstream_gene_variant ; 1103.0bp to feature; MODIFIER silent_mutation Average:82.965; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N
vg0316506170 A -> G LOC_Os03g29045-LOC_Os03g29065 intergenic_region ; MODIFIER silent_mutation Average:82.965; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316506170 A G -0.05 -0.05 -0.05 -0.02 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316506170 NA 5.73E-07 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 8.63E-06 8.63E-06 mr1054_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 3.08E-07 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 6.84E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 5.65E-06 5.65E-06 mr1365_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 8.87E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 6.48E-07 6.48E-07 mr1470_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 1.87E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 5.08E-06 mr1546_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 6.38E-06 6.38E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 6.40E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 7.70E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 5.67E-07 5.67E-07 mr1719_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 6.49E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 3.43E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 1.18E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 5.06E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 9.58E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 NA 2.00E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 4.22E-06 1.01E-07 mr1844_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 3.73E-06 3.73E-06 mr1895_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316506170 2.19E-06 2.19E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251