\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316504158:

Variant ID: vg0316504158 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16504158
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTCCCTCGGCAGCACTGTGCTCGGTTTTGGCTGACGTGGCGCCTACGTTGCTCCTTTGACTATGTTTTCGTCCCACGTGACATTGACGTGGCGCTTAC[A/G]
TGACAATTCGATACCCAAAAATAATAAAAACGTGGGACCCACATGCCAAATACACAAAATAATAAAAAATGATGGGGCCCATGTGGCCCCACATGTCATC

Reverse complement sequence

GATGACATGTGGGGCCACATGGGCCCCATCATTTTTTATTATTTTGTGTATTTGGCATGTGGGTCCCACGTTTTTATTATTTTTGGGTATCGAATTGTCA[T/C]
GTAAGCGCCACGTCAATGTCACGTGGGACGAAAACATAGTCAAAGGAGCAACGTAGGCGCCACGTCAGCCAAAACCGAGCACAGTGCTGCCGAGGGACCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 24.10% 1.65% 19.04% NA
All Indica  2759 78.20% 12.80% 0.33% 8.70% NA
All Japonica  1512 23.20% 34.00% 4.37% 38.43% NA
Aus  269 14.10% 63.90% 0.74% 21.19% NA
Indica I  595 62.20% 35.10% 0.17% 2.52% NA
Indica II  465 92.90% 4.10% 0.22% 2.80% NA
Indica III  913 82.40% 4.90% 0.22% 12.49% NA
Indica Intermediate  786 76.80% 10.10% 0.64% 12.47% NA
Temperate Japonica  767 2.00% 38.10% 7.17% 52.80% NA
Tropical Japonica  504 61.90% 17.70% 1.19% 19.25% NA
Japonica Intermediate  241 10.00% 55.20% 2.07% 32.78% NA
VI/Aromatic  96 10.40% 83.30% 0.00% 6.25% NA
Intermediate  90 55.60% 25.60% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316504158 A -> DEL N N silent_mutation Average:70.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0316504158 A -> G LOC_Os03g29045.1 upstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:70.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg0316504158 A -> G LOC_Os03g29035-LOC_Os03g29045 intergenic_region ; MODIFIER silent_mutation Average:70.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316504158 NA 2.05E-07 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 1.72E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 3.86E-06 3.86E-06 mr1054_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 6.10E-06 6.10E-06 mr1105_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 6.26E-06 6.25E-06 mr1146_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 4.34E-06 4.34E-06 mr1168_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 2.69E-07 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 1.38E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 5.10E-06 5.10E-06 mr1259_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 5.56E-06 5.56E-06 mr1372_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 2.92E-08 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 2.97E-07 2.97E-07 mr1547_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 5.61E-06 NA mr1566_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 2.97E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 4.75E-06 3.00E-07 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 4.28E-06 4.28E-06 mr1681_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 6.12E-06 NA mr1713_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 7.62E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 7.34E-07 1.46E-08 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 3.34E-06 2.11E-06 mr1740_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 2.25E-06 mr1749_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 2.82E-06 mr1761_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 5.00E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 4.01E-06 mr1887_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 6.20E-07 6.20E-07 mr1895_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 NA 1.27E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 6.11E-07 6.11E-07 mr1907_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158 7.63E-07 7.63E-07 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251