Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316504158:

Variant ID: vg0316504158 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16504158
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTCCCTCGGCAGCACTGTGCTCGGTTTTGGCTGACGTGGCGCCTACGTTGCTCCTTTGACTATGTTTTCGTCCCACGTGACATTGACGTGGCGCTTAC[A/G]
TGACAATTCGATACCCAAAAATAATAAAAACGTGGGACCCACATGCCAAATACACAAAATAATAAAAAATGATGGGGCCCATGTGGCCCCACATGTCATC

Reverse complement sequence

GATGACATGTGGGGCCACATGGGCCCCATCATTTTTTATTATTTTGTGTATTTGGCATGTGGGTCCCACGTTTTTATTATTTTTGGGTATCGAATTGTCA[T/C]
GTAAGCGCCACGTCAATGTCACGTGGGACGAAAACATAGTCAAAGGAGCAACGTAGGCGCCACGTCAGCCAAAACCGAGCACAGTGCTGCCGAGGGACCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	24.10%	1.65%	19.04%	NA
All Indica	2759	78.20%	12.80%	0.33%	8.70%	NA
All Japonica	1512	23.20%	34.00%	4.37%	38.43%	NA
Aus	269	14.10%	63.90%	0.74%	21.19%	NA
Indica I	595	62.20%	35.10%	0.17%	2.52%	NA
Indica II	465	92.90%	4.10%	0.22%	2.80%	NA
Indica III	913	82.40%	4.90%	0.22%	12.49%	NA
Indica Intermediate	786	76.80%	10.10%	0.64%	12.47%	NA
Temperate Japonica	767	2.00%	38.10%	7.17%	52.80%	NA
Tropical Japonica	504	61.90%	17.70%	1.19%	19.25%	NA
Japonica Intermediate	241	10.00%	55.20%	2.07%	32.78%	NA
VI/Aromatic	96	10.40%	83.30%	0.00%	6.25%	NA
Intermediate	90	55.60%	25.60%	1.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316504158	A -> DEL	N	N	silent_mutation	Average:70.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0316504158	A -> G	LOC_Os03g29045.1	upstream_gene_variant ; 330.0bp to feature; MODIFIER	silent_mutation	Average:70.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0316504158	A -> G	LOC_Os03g29035-LOC_Os03g29045	intergenic_region ; MODIFIER	silent_mutation	Average:70.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316504158	NA	2.05E-07	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	1.72E-06	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	3.86E-06	3.86E-06	mr1054_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	6.10E-06	6.10E-06	mr1105_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	6.26E-06	6.25E-06	mr1146_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	4.34E-06	4.34E-06	mr1168_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	2.69E-07	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	1.38E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	5.10E-06	5.10E-06	mr1259_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	5.56E-06	5.56E-06	mr1372_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	2.92E-08	mr1542_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	2.97E-07	2.97E-07	mr1547_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	5.61E-06	NA	mr1566_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	2.97E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	4.75E-06	3.00E-07	mr1638_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	4.28E-06	4.28E-06	mr1681_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	6.12E-06	NA	mr1713_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	7.62E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	7.34E-07	1.46E-08	mr1739_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	3.34E-06	2.11E-06	mr1740_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	2.25E-06	mr1749_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	2.82E-06	mr1761_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	5.00E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	4.01E-06	mr1887_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	6.20E-07	6.20E-07	mr1895_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	NA	1.27E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	6.11E-07	6.11E-07	mr1907_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316504158	7.63E-07	7.63E-07	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251