Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316502872:

Variant ID: vg0316502872 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16502872
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTCCCGTCGGCCCTATCCCAGCCACCGCTCGGAGCCGCTCGCCCTTCTGCCACTCGCCCACCTCTCTGCTCCGCTTCCCCCCGCCTCTCTGCTCTGCC[C/T]
GCACACAAAGCCACCGACGACAATGAGGCCGAGCGGCGCGAAGTCATCGGCGCCGCCGCTCCCTATCCGCAGCCGCGCTCACCTGCGGCTGCTGCCTCTT

Reverse complement sequence

AAGAGGCAGCAGCCGCAGGTGAGCGCGGCTGCGGATAGGGAGCGGCGGCGCCGATGACTTCGCGCCGCTCGGCCTCATTGTCGTCGGTGGCTTTGTGTGC[G/A]
GGCAGAGCAGAGAGGCGGGGGGAAGCGGAGCAGAGAGGTGGGCGAGTGGCAGAAGGGCGAGCGGCTCCGAGCGGTGGCTGGGATAGGGCCGACGGGAGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 34.30% 0.99% 14.26% NA
All Indica  2759 71.10% 20.50% 1.49% 6.92% NA
All Japonica  1512 22.70% 49.90% 0.26% 27.18% NA
Aus  269 10.40% 68.40% 0.00% 21.19% NA
Indica I  595 60.00% 39.80% 0.17% 0.00% NA
Indica II  465 83.40% 5.60% 2.80% 8.17% NA
Indica III  913 73.90% 17.20% 0.77% 8.11% NA
Indica Intermediate  786 69.00% 18.40% 2.54% 10.05% NA
Temperate Japonica  767 1.60% 55.30% 0.39% 42.76% NA
Tropical Japonica  504 61.30% 30.60% 0.00% 8.13% NA
Japonica Intermediate  241 9.10% 73.00% 0.41% 17.43% NA
VI/Aromatic  96 8.30% 87.50% 0.00% 4.17% NA
Intermediate  90 48.90% 36.70% 2.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316502872 C -> T LOC_Os03g29045.1 upstream_gene_variant ; 1616.0bp to feature; MODIFIER silent_mutation Average:77.842; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg0316502872 C -> T LOC_Os03g29035-LOC_Os03g29045 intergenic_region ; MODIFIER silent_mutation Average:77.842; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N
vg0316502872 C -> DEL N N silent_mutation Average:77.842; most accessible tissue: Zhenshan97 young leaf, score: 88.878 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316502872 C T 0.0 -0.01 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316502872 NA 4.54E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316502872 NA 8.59E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316502872 NA 1.04E-07 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316502872 NA 6.38E-09 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316502872 NA 2.42E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316502872 NA 4.70E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316502872 1.50E-07 1.50E-07 mr1895_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251