\
| Variant ID: vg0316492889 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16492889 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 268. )
AAAATTTTTCTACTGCGTAAACCAGGAACCATGCAAGTATTAGATCATAGATCGTTACCACTCGACGCGCTGCGCAGCGGAAGAAGACGCTAAGAAGTCG[A/G]
AGGAACTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAAGTAGTCGATCGCACCGGCCCGACCATCTCCTCCTCGTGCGTTCTCCTCGCCGTACTCCCAC
GTGGGAGTACGGCGAGGAGAACGCACGAGGAGGAGATGGTCGGGCCGGTGCGATCGACTACTTCCTCTACATCGACGCGCGCTACTTCGCGAGAGTTCCT[T/C]
CGACTTCTTAGCGTCTTCTTCCGCTGCGCAGCGCGTCGAGTGGTAACGATCTATGATCTAATACTTGCATGGTTCCTGGTTTACGCAGTAGAAAAATTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 10.00% | 0.53% | 10.26% | NA |
| All Indica | 2759 | 96.80% | 0.30% | 0.47% | 2.43% | NA |
| All Japonica | 1512 | 43.40% | 30.20% | 0.60% | 25.79% | NA |
| Aus | 269 | 92.90% | 0.00% | 1.12% | 5.95% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 0.20% | 0.43% | 1.51% | NA |
| Indica III | 913 | 95.50% | 0.10% | 1.10% | 3.29% | NA |
| Indica Intermediate | 786 | 95.30% | 0.80% | 0.13% | 3.82% | NA |
| Temperate Japonica | 767 | 54.10% | 4.60% | 0.52% | 40.81% | NA |
| Tropical Japonica | 504 | 28.80% | 62.90% | 0.40% | 7.94% | NA |
| Japonica Intermediate | 241 | 39.80% | 43.60% | 1.24% | 15.35% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 81.10% | 10.00% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316492889 | A -> DEL | N | N | silent_mutation | Average:54.553; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 | N | N | N | N |
| vg0316492889 | A -> G | LOC_Os03g29035.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.553; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316492889 | NA | 1.78E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 9.33E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | 1.62E-06 | 6.81E-09 | mr1020_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 7.19E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 3.42E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 1.11E-06 | mr1470_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 1.33E-06 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 2.09E-08 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 2.92E-06 | mr1546_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 5.67E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 4.02E-10 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 1.43E-07 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316492889 | NA | 8.74E-09 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |