\
| Variant ID: vg0316491917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16491917 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.15, G: 0.01, others allele: 0.00, population size: 101. )
CTCGTTTTAGGGTTTCTGCCGGTATCGGCTAAATCGCGTTGCTAGATTAGATTAGCTTAGACATCTACTACCCTGAAAATTCAGTCGACGGCTTGATTGT[C/T]
TAGATATTGTGTTTCTTTTCATACTTAGTGCTGCATCAATTAAGTTTGATCTACTAAGTCGTGCTTAGAACCATAATCTCTAGCCTGCCTTTGACTGCCA
TGGCAGTCAAAGGCAGGCTAGAGATTATGGTTCTAAGCACGACTTAGTAGATCAAACTTAATTGATGCAGCACTAAGTATGAAAAGAAACACAATATCTA[G/A]
ACAATCAAGCCGTCGACTGAATTTTCAGGGTAGTAGATGTCTAAGCTAATCTAATCTAGCAACGCGATTTAGCCGATACCGGCAGAAACCCTAAAACGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.90% | 37.00% | 0.63% | 12.51% | NA |
| All Indica | 2759 | 75.60% | 19.50% | 0.80% | 4.06% | NA |
| All Japonica | 1512 | 1.80% | 70.90% | 0.40% | 26.92% | NA |
| Aus | 269 | 72.50% | 5.90% | 0.37% | 21.19% | NA |
| Indica I | 595 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.30% | 5.80% | 0.22% | 1.72% | NA |
| Indica III | 913 | 78.10% | 15.20% | 1.53% | 5.15% | NA |
| Indica Intermediate | 786 | 74.70% | 17.20% | 0.89% | 7.25% | NA |
| Temperate Japonica | 767 | 1.70% | 55.70% | 0.52% | 42.11% | NA |
| Tropical Japonica | 504 | 2.20% | 89.10% | 0.40% | 8.33% | NA |
| Japonica Intermediate | 241 | 1.20% | 81.30% | 0.00% | 17.43% | NA |
| VI/Aromatic | 96 | 8.30% | 87.50% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 44.40% | 42.20% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316491917 | C -> T | LOC_Os03g29035.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.455; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| vg0316491917 | C -> DEL | N | N | silent_mutation | Average:36.455; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316491917 | NA | 3.76E-07 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | NA | 1.89E-07 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | NA | 1.95E-14 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | 1.85E-06 | 3.77E-06 | mr1296_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | NA | 6.45E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | NA | 6.56E-06 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | NA | 3.38E-09 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | 5.19E-06 | 3.03E-13 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | NA | 2.51E-11 | mr1749_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | 6.95E-06 | 3.85E-13 | mr1761_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | NA | 4.12E-06 | mr1761_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316491917 | NA | 6.82E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |