\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316484534:

Variant ID: vg0316484534 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16484534
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCACCGGCTCGACCTTCTCCTCCTCGTGCGTTCTCCTTACCGTACTCCCACGCCGATTAGCACCCCAAACCAGTGGCGCCTCTACCGGTATCCACACGTA[C/T]
AGGGACGGAACGCCACGCACAGATGTGCTAGCACCCGCGTGCGGCTAGGATTTTGCTCGGGAAGGGAGTGGTGGTTAGGGTTTCTCACGTGATGCAATCC

Reverse complement sequence

GGATTGCATCACGTGAGAAACCCTAACCACCACTCCCTTCCCGAGCAAAATCCTAGCCGCACGCGGGTGCTAGCACATCTGTGCGTGGCGTTCCGTCCCT[G/A]
TACGTGTGGATACCGGTAGAGGCGCCACTGGTTTGGGGTGCTAATCGGCGTGGGAGTACGGTAAGGAGAACGCACGAGGAGGAGAAGGTCGAGCCGGTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 10.20% 0.47% 12.21% NA
All Indica  2759 95.00% 0.30% 0.36% 4.31% NA
All Japonica  1512 43.10% 30.60% 0.60% 25.79% NA
Aus  269 78.80% 0.40% 0.74% 20.07% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 0.20% 0.00% 1.94% NA
Indica III  913 93.20% 0.10% 0.88% 5.81% NA
Indica Intermediate  786 91.70% 0.80% 0.25% 7.25% NA
Temperate Japonica  767 54.10% 4.70% 0.65% 40.55% NA
Tropical Japonica  504 28.40% 63.30% 0.40% 7.94% NA
Japonica Intermediate  241 38.60% 44.40% 0.83% 16.18% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 75.60% 12.20% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316484534 C -> T LOC_Os03g29035.1 downstream_gene_variant ; 2100.0bp to feature; MODIFIER silent_mutation Average:77.617; most accessible tissue: Minghui63 young leaf, score: 89.224 N N N N
vg0316484534 C -> T LOC_Os03g29020-LOC_Os03g29035 intergenic_region ; MODIFIER silent_mutation Average:77.617; most accessible tissue: Minghui63 young leaf, score: 89.224 N N N N
vg0316484534 C -> DEL N N silent_mutation Average:77.617; most accessible tissue: Minghui63 young leaf, score: 89.224 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316484534 C T -0.03 0.0 -0.01 -0.02 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316484534 NA 1.56E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 4.03E-09 mr1852 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 2.73E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 6.57E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 9.68E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 1.68E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 2.29E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 1.81E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 6.09E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 2.05E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 1.53E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316484534 NA 7.57E-08 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251