\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316482661:

Variant ID: vg0316482661 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16482661
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGAGTGGTGTTCCCGCTGCAATCCAAGTCAAGGCTTAGCTCTATTTATCTTTTAATTTTCCGCTGCATTTATGTAAGACTTTTATGATGTTTGTAAGA[T/C]
GTGGATCTGTATGTCAACTTTGTCGTTTGTGTACCCCGGCCGGTCCTGGACGGGGATTTTAATGCACATTCTACTTGGAATTCTATTCGGGAATTTCTGA

Reverse complement sequence

TCAGAAATTCCCGAATAGAATTCCAAGTAGAATGTGCATTAAAATCCCCGTCCAGGACCGGCCGGGGTACACAAACGACAAAGTTGACATACAGATCCAC[A/G]
TCTTACAAACATCATAAAAGTCTTACATAAATGCAGCGGAAAATTAAAAGATAAATAGAGCTAAGCCTTGACTTGGATTGCAGCGGGAACACCACTCCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 12.50% 1.76% 9.82% NA
All Indica  2759 94.20% 3.50% 1.16% 1.16% NA
All Japonica  1512 43.00% 30.60% 0.73% 25.66% NA
Aus  269 74.70% 5.60% 10.78% 8.92% NA
Indica I  595 97.80% 2.00% 0.17% 0.00% NA
Indica II  465 98.30% 0.20% 1.08% 0.43% NA
Indica III  913 92.30% 5.90% 0.77% 0.99% NA
Indica Intermediate  786 91.20% 3.70% 2.42% 2.67% NA
Temperate Japonica  767 53.60% 4.70% 0.65% 41.07% NA
Tropical Japonica  504 29.00% 63.10% 0.60% 7.34% NA
Japonica Intermediate  241 38.60% 45.20% 1.24% 14.94% NA
VI/Aromatic  96 74.00% 6.20% 7.29% 12.50% NA
Intermediate  90 73.30% 13.30% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316482661 T -> C LOC_Os03g29035.1 downstream_gene_variant ; 3973.0bp to feature; MODIFIER silent_mutation Average:72.56; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N
vg0316482661 T -> C LOC_Os03g29020-LOC_Os03g29035 intergenic_region ; MODIFIER silent_mutation Average:72.56; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N
vg0316482661 T -> DEL N N silent_mutation Average:72.56; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316482661 NA 9.69E-06 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 3.23E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 8.39E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 3.16E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 3.98E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 6.21E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 6.51E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 1.52E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 2.40E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 1.87E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 6.04E-10 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 4.54E-06 mr1546_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 9.58E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 1.79E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 1.37E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 5.18E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 1.17E-06 1.16E-06 mr1777_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 3.11E-08 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 1.23E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 3.06E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661 NA 4.85E-06 mr1894_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251