Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316482661:

Variant ID: vg0316482661 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16482661
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGGAGTGGTGTTCCCGCTGCAATCCAAGTCAAGGCTTAGCTCTATTTATCTTTTAATTTTCCGCTGCATTTATGTAAGACTTTTATGATGTTTGTAAGA[T/C]
GTGGATCTGTATGTCAACTTTGTCGTTTGTGTACCCCGGCCGGTCCTGGACGGGGATTTTAATGCACATTCTACTTGGAATTCTATTCGGGAATTTCTGA

Reverse complement sequence

TCAGAAATTCCCGAATAGAATTCCAAGTAGAATGTGCATTAAAATCCCCGTCCAGGACCGGCCGGGGTACACAAACGACAAAGTTGACATACAGATCCAC[A/G]
TCTTACAAACATCATAAAAGTCTTACATAAATGCAGCGGAAAATTAAAAGATAAATAGAGCTAAGCCTTGACTTGGATTGCAGCGGGAACACCACTCCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	12.50%	1.76%	9.82%	NA
All Indica	2759	94.20%	3.50%	1.16%	1.16%	NA
All Japonica	1512	43.00%	30.60%	0.73%	25.66%	NA
Aus	269	74.70%	5.60%	10.78%	8.92%	NA
Indica I	595	97.80%	2.00%	0.17%	0.00%	NA
Indica II	465	98.30%	0.20%	1.08%	0.43%	NA
Indica III	913	92.30%	5.90%	0.77%	0.99%	NA
Indica Intermediate	786	91.20%	3.70%	2.42%	2.67%	NA
Temperate Japonica	767	53.60%	4.70%	0.65%	41.07%	NA
Tropical Japonica	504	29.00%	63.10%	0.60%	7.34%	NA
Japonica Intermediate	241	38.60%	45.20%	1.24%	14.94%	NA
VI/Aromatic	96	74.00%	6.20%	7.29%	12.50%	NA
Intermediate	90	73.30%	13.30%	4.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316482661	T -> C	LOC_Os03g29035.1	downstream_gene_variant ; 3973.0bp to feature; MODIFIER	silent_mutation	Average:72.56; most accessible tissue: Zhenshan97 flag leaf, score: 87.378	N	N	N	N
vg0316482661	T -> C	LOC_Os03g29020-LOC_Os03g29035	intergenic_region ; MODIFIER	silent_mutation	Average:72.56; most accessible tissue: Zhenshan97 flag leaf, score: 87.378	N	N	N	N
vg0316482661	T -> DEL	N	N	silent_mutation	Average:72.56; most accessible tissue: Zhenshan97 flag leaf, score: 87.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316482661	NA	9.69E-06	mr1006_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	3.23E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	8.39E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	3.16E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	3.98E-07	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	6.21E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	6.51E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	1.52E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	2.40E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	1.87E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	6.04E-10	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	4.54E-06	mr1546_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	9.58E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	1.79E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	1.37E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	5.18E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	1.17E-06	1.16E-06	mr1777_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	3.11E-08	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	1.23E-06	mr1813_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	3.06E-08	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316482661	NA	4.85E-06	mr1894_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251