Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316474025:

Variant ID: vg0316474025 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16474025
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.25, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ACCATCTTGTGTGAATGCTTCAACCATTTGCTTCTTGTTTCCTCCATACACTCCGAACACGCCCATTTCCCTTTCACAGTTTGGCCAGAAAAGTTGCCAA[A/G]
GGCCGGATAATTGTTGATGGTACAAAACAGCATCGCATGGAGGTTGAAATACTCTTGTGCATATGCGTCCCATGTTCGTGTGCTCTCATTCCATAGCCTT

Reverse complement sequence

AAGGCTATGGAATGAGAGCACACGAACATGGGACGCATATGCACAAGAGTATTTCAACCTCCATGCGATGCTGTTTTGTACCATCAACAATTATCCGGCC[T/C]
TTGGCAACTTTTCTGGCCAAACTGTGAAAGGGAAATGGGCGTGTTCGGAGTGTATGGAGGAAACAAGAAGCAAATGGTTGAAGCATTCACACAAGATGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	12.20%	1.50%	11.36%	NA
All Indica	2759	91.70%	3.60%	2.17%	2.54%	NA
All Japonica	1512	43.10%	30.20%	0.26%	26.46%	NA
Aus	269	75.10%	3.70%	1.12%	20.07%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	97.80%	0.20%	0.43%	1.51%	NA
Indica III	913	87.20%	6.10%	4.82%	1.86%	NA
Indica Intermediate	786	88.70%	3.70%	1.78%	5.85%	NA
Temperate Japonica	767	53.50%	4.70%	0.13%	41.72%	NA
Tropical Japonica	504	29.40%	62.30%	0.40%	7.94%	NA
Japonica Intermediate	241	39.00%	44.00%	0.41%	16.60%	NA
VI/Aromatic	96	91.70%	4.20%	0.00%	4.17%	NA
Intermediate	90	74.40%	11.10%	4.44%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316474025	A -> DEL	LOC_Os03g29020.1	N	frameshift_variant	Average:42.49; most accessible tissue: Minghui63 flag leaf, score: 66.004	N	N	N	N
vg0316474025	A -> G	LOC_Os03g29020.1	missense_variant ; p.Phe452Leu; MODERATE	nonsynonymous_codon ; F452L	Average:42.49; most accessible tissue: Minghui63 flag leaf, score: 66.004	possibly damaging	-1.952	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316474025	NA	2.72E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	7.21E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	7.76E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	3.89E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	5.97E-10	mr1220_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	3.72E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	2.57E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	7.16E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	1.98E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	7.34E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	5.46E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	2.46E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	2.79E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	1.41E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	6.01E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	2.08E-06	2.08E-06	mr1777_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	1.34E-08	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	4.02E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316474025	NA	7.04E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251