\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316455753:

Variant ID: vg0316455753 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16455753
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


GCATAGATATCCCAAGATGTACGTTATTTGTGGTTATTAAGGTGAGTTAACCATCCTGCCAAATCAGATCTTACAAATAATACTACATATTGGCCTTGTA[T/C]
ATATATGTATTTAAAATTTATTATATTTTGAAACAGAGGTAGTAGTTTAATTATTGATATAAAAATCTATTAGGAAAAACTTTATCTGACAGGATGCACC

Reverse complement sequence

GGTGCATCCTGTCAGATAAAGTTTTTCCTAATAGATTTTTATATCAATAATTAAACTACTACCTCTGTTTCAAAATATAATAAATTTTAAATACATATAT[A/G]
TACAAGGCCAATATGTAGTATTATTTGTAAGATCTGATTTGGCAGGATGGTTAACTCACCTTAATAACCACAAATAACGTACATCTTGGGATATCTATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 24.20% 0.23% 12.00% NA
All Indica  2759 81.30% 15.80% 0.04% 2.86% NA
All Japonica  1512 32.10% 39.90% 0.53% 27.45% NA
Aus  269 76.60% 1.10% 0.74% 21.56% NA
Indica I  595 62.00% 38.00% 0.00% 0.00% NA
Indica II  465 92.70% 5.60% 0.00% 1.72% NA
Indica III  913 89.30% 8.50% 0.11% 2.08% NA
Indica Intermediate  786 79.80% 13.60% 0.00% 6.62% NA
Temperate Japonica  767 5.60% 50.30% 1.04% 43.02% NA
Tropical Japonica  504 65.90% 25.60% 0.00% 8.53% NA
Japonica Intermediate  241 46.10% 36.50% 0.00% 17.43% NA
VI/Aromatic  96 12.50% 83.30% 0.00% 4.17% NA
Intermediate  90 64.40% 23.30% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316455753 T -> C LOC_Os03g28990.1 upstream_gene_variant ; 1765.0bp to feature; MODIFIER silent_mutation Average:73.598; most accessible tissue: Callus, score: 95.846 N N N N
vg0316455753 T -> C LOC_Os03g28990.2 upstream_gene_variant ; 1765.0bp to feature; MODIFIER silent_mutation Average:73.598; most accessible tissue: Callus, score: 95.846 N N N N
vg0316455753 T -> C LOC_Os03g28980.1 downstream_gene_variant ; 3785.0bp to feature; MODIFIER silent_mutation Average:73.598; most accessible tissue: Callus, score: 95.846 N N N N
vg0316455753 T -> C LOC_Os03g28980-LOC_Os03g28990 intergenic_region ; MODIFIER silent_mutation Average:73.598; most accessible tissue: Callus, score: 95.846 N N N N
vg0316455753 T -> DEL N N silent_mutation Average:73.598; most accessible tissue: Callus, score: 95.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316455753 NA 8.63E-07 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 3.29E-06 mr1006_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 1.34E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 9.52E-06 mr1403_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 2.02E-06 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 6.60E-08 6.60E-08 mr1470_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 3.10E-08 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 5.34E-06 mr1546_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 1.11E-07 1.11E-07 mr1719_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 7.65E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 3.32E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 NA 8.53E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 1.21E-06 1.21E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316455753 3.24E-06 3.24E-06 mr1927_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251