\
| Variant ID: vg0316455753 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16455753 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 182. )
GCATAGATATCCCAAGATGTACGTTATTTGTGGTTATTAAGGTGAGTTAACCATCCTGCCAAATCAGATCTTACAAATAATACTACATATTGGCCTTGTA[T/C]
ATATATGTATTTAAAATTTATTATATTTTGAAACAGAGGTAGTAGTTTAATTATTGATATAAAAATCTATTAGGAAAAACTTTATCTGACAGGATGCACC
GGTGCATCCTGTCAGATAAAGTTTTTCCTAATAGATTTTTATATCAATAATTAAACTACTACCTCTGTTTCAAAATATAATAAATTTTAAATACATATAT[A/G]
TACAAGGCCAATATGTAGTATTATTTGTAAGATCTGATTTGGCAGGATGGTTAACTCACCTTAATAACCACAAATAACGTACATCTTGGGATATCTATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 24.20% | 0.23% | 12.00% | NA |
| All Indica | 2759 | 81.30% | 15.80% | 0.04% | 2.86% | NA |
| All Japonica | 1512 | 32.10% | 39.90% | 0.53% | 27.45% | NA |
| Aus | 269 | 76.60% | 1.10% | 0.74% | 21.56% | NA |
| Indica I | 595 | 62.00% | 38.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.70% | 5.60% | 0.00% | 1.72% | NA |
| Indica III | 913 | 89.30% | 8.50% | 0.11% | 2.08% | NA |
| Indica Intermediate | 786 | 79.80% | 13.60% | 0.00% | 6.62% | NA |
| Temperate Japonica | 767 | 5.60% | 50.30% | 1.04% | 43.02% | NA |
| Tropical Japonica | 504 | 65.90% | 25.60% | 0.00% | 8.53% | NA |
| Japonica Intermediate | 241 | 46.10% | 36.50% | 0.00% | 17.43% | NA |
| VI/Aromatic | 96 | 12.50% | 83.30% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 64.40% | 23.30% | 0.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316455753 | T -> C | LOC_Os03g28990.1 | upstream_gene_variant ; 1765.0bp to feature; MODIFIER | silent_mutation | Average:73.598; most accessible tissue: Callus, score: 95.846 | N | N | N | N |
| vg0316455753 | T -> C | LOC_Os03g28990.2 | upstream_gene_variant ; 1765.0bp to feature; MODIFIER | silent_mutation | Average:73.598; most accessible tissue: Callus, score: 95.846 | N | N | N | N |
| vg0316455753 | T -> C | LOC_Os03g28980.1 | downstream_gene_variant ; 3785.0bp to feature; MODIFIER | silent_mutation | Average:73.598; most accessible tissue: Callus, score: 95.846 | N | N | N | N |
| vg0316455753 | T -> C | LOC_Os03g28980-LOC_Os03g28990 | intergenic_region ; MODIFIER | silent_mutation | Average:73.598; most accessible tissue: Callus, score: 95.846 | N | N | N | N |
| vg0316455753 | T -> DEL | N | N | silent_mutation | Average:73.598; most accessible tissue: Callus, score: 95.846 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316455753 | NA | 8.63E-07 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 3.29E-06 | mr1006_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 1.34E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 9.52E-06 | mr1403_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 2.02E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | 6.60E-08 | 6.60E-08 | mr1470_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 3.10E-08 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 5.34E-06 | mr1546_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | 1.11E-07 | 1.11E-07 | mr1719_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 7.65E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 3.32E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | NA | 8.53E-06 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | 1.21E-06 | 1.21E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316455753 | 3.24E-06 | 3.24E-06 | mr1927_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |