Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0316396424:

Variant ID: vg0316396424 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16396424
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAACAAAAAATGAAACGAATTCCCTTGATATGGGGTTTCCAAAATATGTGGGTTTTTTTGTTGCAATGGAATATTTCAGTTCACTGCAACATTAGATCT[G/A]
TACATAGTGAAATATTGTGAGTACACTAGGTGAAACATTTTTTTTTGGAACAAAAAATAAACCAAATTCCCTTTATAGGGGGTTTCCAAAATATGTGGGT

Reverse complement sequence

ACCCACATATTTTGGAAACCCCCTATAAAGGGAATTTGGTTTATTTTTTGTTCCAAAAAAAAATGTTTCACCTAGTGTACTCACAATATTTCACTATGTA[C/T]
AGATCTAATGTTGCAGTGAACTGAAATATTCCATTGCAACAAAAAAACCCACATATTTTGGAAACCCCATATCAAGGGAATTCGTTTCATTTTTTGTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	2.20%	19.36%	35.80%	NA
All Indica	2759	22.40%	3.40%	24.65%	49.51%	NA
All Japonica	1512	78.50%	0.10%	9.92%	11.51%	NA
Aus	269	27.10%	3.30%	25.28%	44.24%	NA
Indica I	595	41.20%	2.00%	10.25%	46.55%	NA
Indica II	465	12.70%	0.00%	41.08%	46.24%	NA
Indica III	913	12.50%	6.20%	25.74%	55.53%	NA
Indica Intermediate	786	25.60%	3.20%	24.55%	46.69%	NA
Temperate Japonica	767	99.50%	0.00%	0.13%	0.39%	NA
Tropical Japonica	504	40.30%	0.20%	28.17%	31.35%	NA
Japonica Intermediate	241	91.70%	0.00%	2.90%	5.39%	NA
VI/Aromatic	96	91.70%	2.10%	2.08%	4.17%	NA
Intermediate	90	51.10%	0.00%	16.67%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316396424	G -> A	LOC_Os03g28910.1	downstream_gene_variant ; 822.0bp to feature; MODIFIER	silent_mutation	Average:21.795; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0316396424	G -> A	LOC_Os03g28920.1	downstream_gene_variant ; 4155.0bp to feature; MODIFIER	silent_mutation	Average:21.795; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0316396424	G -> A	LOC_Os03g28410-LOC_Os03g28910	intergenic_region ; MODIFIER	silent_mutation	Average:21.795; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0316396424	G -> DEL	N	N	silent_mutation	Average:21.795; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316396424	1.25E-06	NA	mr1707	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316396424	4.56E-06	NA	mr1707	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316396424	1.10E-06	NA	mr1874_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316396424	NA	6.27E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251