\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316353556:

Variant ID: vg0316353556 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16353556
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGAGAAGTTGAAGGCCGAGGCATCTTCGGTAGGGACCCCTCGCACTTTTGCACCCATGTCAGTAAGGGCGAGGCGAAGCGTTTGGCACGCCGTTCTTG[C/T]
AGATTCGGTAGTTTTCACCATCTCCCGCGAAAACCGCTGCGACTCCTCCACAGCGCTCGCTTCGGCCTTGCTGACCTCCAGGCGAAGAGCCTCCATCTTT

Reverse complement sequence

AAAGATGGAGGCTCTTCGCCTGGAGGTCAGCAAGGCCGAAGCGAGCGCTGTGGAGGAGTCGCAGCGGTTTTCGCGGGAGATGGTGAAAACTACCGAATCT[G/A]
CAAGAACGGCGTGCCAAACGCTTCGCCTCGCCCTTACTGACATGGGTGCAAAAGTGCGAGGGGTCCCTACCGAAGATGCCTCGGCCTTCAACTTCTCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 3.70% 0.42% 1.44% NA
All Indica  2759 99.70% 0.20% 0.04% 0.00% NA
All Japonica  1512 83.50% 10.80% 1.19% 4.50% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 92.70% 5.20% 0.52% 1.56% NA
Tropical Japonica  504 88.30% 4.40% 2.18% 5.16% NA
Japonica Intermediate  241 44.40% 41.90% 1.24% 12.45% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316353556 C -> T LOC_Os03g28380.1 missense_variant ; p.Ala582Thr; MODERATE nonsynonymous_codon ; A582T Average:68.899; most accessible tissue: Minghui63 panicle, score: 82.128 benign 0.733 TOLERATED 0.09
vg0316353556 C -> DEL LOC_Os03g28380.1 N frameshift_variant Average:68.899; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316353556 NA 1.41E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 2.65E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 7.83E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 1.43E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 3.48E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 4.36E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 4.43E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 6.76E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 3.95E-09 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 8.61E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 3.04E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 NA 4.51E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556 2.56E-06 1.82E-09 mr1961_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251