Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316353556:

Variant ID: vg0316353556 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16353556
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGAGAAGTTGAAGGCCGAGGCATCTTCGGTAGGGACCCCTCGCACTTTTGCACCCATGTCAGTAAGGGCGAGGCGAAGCGTTTGGCACGCCGTTCTTG[C/T]
AGATTCGGTAGTTTTCACCATCTCCCGCGAAAACCGCTGCGACTCCTCCACAGCGCTCGCTTCGGCCTTGCTGACCTCCAGGCGAAGAGCCTCCATCTTT

Reverse complement sequence

AAAGATGGAGGCTCTTCGCCTGGAGGTCAGCAAGGCCGAAGCGAGCGCTGTGGAGGAGTCGCAGCGGTTTTCGCGGGAGATGGTGAAAACTACCGAATCT[G/A]
CAAGAACGGCGTGCCAAACGCTTCGCCTCGCCCTTACTGACATGGGTGCAAAAGTGCGAGGGGTCCCTACCGAAGATGCCTCGGCCTTCAACTTCTCCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	3.70%	0.42%	1.44%	NA
All Indica	2759	99.70%	0.20%	0.04%	0.00%	NA
All Japonica	1512	83.50%	10.80%	1.19%	4.50%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	92.70%	5.20%	0.52%	1.56%	NA
Tropical Japonica	504	88.30%	4.40%	2.18%	5.16%	NA
Japonica Intermediate	241	44.40%	41.90%	1.24%	12.45%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316353556	C -> T	LOC_Os03g28380.1	missense_variant ; p.Ala582Thr; MODERATE	nonsynonymous_codon ; A582T	Average:68.899; most accessible tissue: Minghui63 panicle, score: 82.128	benign	0.733	TOLERATED	0.09
vg0316353556	C -> DEL	LOC_Os03g28380.1	N	frameshift_variant	Average:68.899; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316353556	NA	1.41E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	2.65E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	7.83E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	1.43E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	3.48E-08	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	4.36E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	4.43E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	6.76E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	3.95E-09	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	8.61E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	3.04E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	NA	4.51E-08	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316353556	2.56E-06	1.82E-09	mr1961_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251