\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316243138:

Variant ID: vg0316243138 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16243138
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCGAGGACGACGACGACGCGGCGGGCAACCTCCTCGCCCGGCCACCTCCGCCGTTGCTGCCCCCTCCTCCACCCACCTCCACCTGCCGACTATGCTCC[T/C]
CCTCCGGCGGGCGGCGGAGCGGAGCGGGGGTGGCGGCTGGCGAAGGGTAAGGAGCCCGCCACGTCAGCTCCGGCAACGGCGACGGCATCGGCATCGTGGT

Reverse complement sequence

ACCACGATGCCGATGCCGTCGCCGTTGCCGGAGCTGACGTGGCGGGCTCCTTACCCTTCGCCAGCCGCCACCCCCGCTCCGCTCCGCCGCCCGCCGGAGG[A/G]
GGAGCATAGTCGGCAGGTGGAGGTGGGTGGAGGAGGGGGCAGCAACGGCGGAGGTGGCCGGGCGAGGAGGTTGCCCGCCGCGTCGTCGTCGTCCTCGCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 2.80% 3.26% 1.46% NA
All Indica  2759 99.60% 0.20% 0.11% 0.04% NA
All Japonica  1512 77.40% 8.30% 9.85% 4.43% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.40% 0.33% 0.11% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 87.70% 0.30% 10.43% 1.56% NA
Tropical Japonica  504 58.90% 22.40% 12.90% 5.75% NA
Japonica Intermediate  241 83.40% 4.10% 1.66% 10.79% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316243138 T -> C LOC_Os03g28220.1 upstream_gene_variant ; 3854.0bp to feature; MODIFIER silent_mutation Average:86.853; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0316243138 T -> C LOC_Os03g28230.1 upstream_gene_variant ; 1499.0bp to feature; MODIFIER silent_mutation Average:86.853; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0316243138 T -> C LOC_Os03g28250.1 upstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:86.853; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0316243138 T -> C LOC_Os03g28230-LOC_Os03g28250 intergenic_region ; MODIFIER silent_mutation Average:86.853; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N
vg0316243138 T -> DEL N N silent_mutation Average:86.853; most accessible tissue: Zhenshan97 panicle, score: 97.277 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316243138 T C 0.01 0.0 0.01 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316243138 4.37E-06 2.00E-08 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 1.99E-06 1.98E-08 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 6.41E-06 5.57E-09 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 6.47E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 2.34E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 8.57E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 6.89E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 3.35E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 6.67E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 3.04E-07 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 2.55E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 1.70E-06 NA mr1600_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 2.94E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 7.73E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 7.12E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 7.36E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 9.20E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 5.94E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316243138 NA 2.52E-07 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251