\
| Variant ID: vg0316224648 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16224648 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 232. )
CATTTCCAACCCAAAGGAAATGCACAATATTACTCTGAACACCAACAGGCATCGTCATCTTCTTCCTCCTCCCTCCTTCGGTCAGCTCCGGGAGGATGAG[C/T]
AGCTTGCAGAGGGCATCAATGGAGGATGAGCAGCTTGCAGAGCTCGTACAGGGTCGTGGGAGCATCTGGCGCTCCCGTGCGCCACGTCGTCGTCGCCGCC
GGCGGCGACGACGACGTGGCGCACGGGAGCGCCAGATGCTCCCACGACCCTGTACGAGCTCTGCAAGCTGCTCATCCTCCATTGATGCCCTCTGCAAGCT[G/A]
CTCATCCTCCCGGAGCTGACCGAAGGAGGGAGGAGGAAGAAGATGACGATGCCTGTTGGTGTTCAGAGTAATATTGTGCATTTCCTTTGGGTTGGAAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.60% | 0.40% | 5.10% | 38.87% | NA |
| All Indica | 2759 | 32.00% | 0.60% | 7.97% | 59.44% | NA |
| All Japonica | 1512 | 89.40% | 0.00% | 0.66% | 9.92% | NA |
| Aus | 269 | 94.80% | 0.00% | 2.23% | 2.97% | NA |
| Indica I | 595 | 47.10% | 0.30% | 3.19% | 49.41% | NA |
| Indica II | 465 | 14.40% | 0.40% | 10.11% | 75.05% | NA |
| Indica III | 913 | 29.70% | 0.90% | 11.28% | 58.16% | NA |
| Indica Intermediate | 786 | 33.70% | 0.50% | 6.49% | 59.29% | NA |
| Temperate Japonica | 767 | 96.90% | 0.00% | 0.00% | 3.13% | NA |
| Tropical Japonica | 504 | 81.70% | 0.00% | 1.39% | 16.87% | NA |
| Japonica Intermediate | 241 | 81.70% | 0.00% | 1.24% | 17.01% | NA |
| VI/Aromatic | 96 | 88.50% | 1.00% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 61.10% | 1.10% | 3.33% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316224648 | C -> T | LOC_Os03g28180.1 | upstream_gene_variant ; 2711.0bp to feature; MODIFIER | silent_mutation | Average:50.4; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0316224648 | C -> T | LOC_Os03g28204.1 | upstream_gene_variant ; 4765.0bp to feature; MODIFIER | silent_mutation | Average:50.4; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0316224648 | C -> T | LOC_Os03g28190.1 | downstream_gene_variant ; 3009.0bp to feature; MODIFIER | silent_mutation | Average:50.4; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0316224648 | C -> T | LOC_Os03g28180-LOC_Os03g28190 | intergenic_region ; MODIFIER | silent_mutation | Average:50.4; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0316224648 | C -> DEL | N | N | silent_mutation | Average:50.4; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316224648 | NA | 9.95E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316224648 | NA | 5.04E-08 | mr1285 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316224648 | NA | 1.46E-06 | mr1358 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316224648 | NA | 3.91E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316224648 | NA | 5.10E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316224648 | NA | 8.48E-06 | mr1956 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |