Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316222868:

Variant ID: vg0316222868 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16222868
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAACTCCATGTCACGAAGAAACTAGTACTCCCTCTGTTTCACAATGTAAGACTTTTTAGCATTGCCCACGTACATATAGATGTTAATGAATCTAAAAA[T/C]
ATACATATGTCTAGATTCATTAACATCTAAATGAATGTGGACAATGCTAGAAAGTCTTACATCGTGAAACCGAGGAAGTATTAGACACTACTCTTTCAAT

Reverse complement sequence

ATTGAAAGAGTAGTGTCTAATACTTCCTCGGTTTCACGATGTAAGACTTTCTAGCATTGTCCACATTCATTTAGATGTTAATGAATCTAGACATATGTAT[A/G]
TTTTTAGATTCATTAACATCTATATGTACGTGGGCAATGCTAAAAAGTCTTACATTGTGAAACAGAGGGAGTACTAGTTTCTTCGTGACATGGAGTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.20%	28.00%	2.92%	40.82%	NA
All Indica	2759	6.00%	27.10%	4.28%	62.63%	NA
All Japonica	1512	62.80%	26.70%	0.99%	9.52%	NA
Aus	269	40.50%	54.30%	0.74%	4.46%	NA
Indica I	595	2.90%	44.50%	3.53%	49.08%	NA
Indica II	465	4.50%	10.80%	4.09%	80.65%	NA
Indica III	913	6.70%	24.80%	4.82%	63.75%	NA
Indica Intermediate	786	8.40%	26.30%	4.33%	60.94%	NA
Temperate Japonica	767	90.90%	6.00%	0.26%	2.87%	NA
Tropical Japonica	504	30.00%	51.60%	1.79%	16.67%	NA
Japonica Intermediate	241	41.90%	40.70%	1.66%	15.77%	NA
VI/Aromatic	96	86.50%	2.10%	1.04%	10.42%	NA
Intermediate	90	31.10%	27.80%	2.22%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316222868	T -> C	LOC_Os03g28180.1	upstream_gene_variant ; 931.0bp to feature; MODIFIER	silent_mutation	Average:37.559; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0316222868	T -> C	LOC_Os03g28175.1	downstream_gene_variant ; 4136.0bp to feature; MODIFIER	silent_mutation	Average:37.559; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0316222868	T -> C	LOC_Os03g28190.1	downstream_gene_variant ; 4789.0bp to feature; MODIFIER	silent_mutation	Average:37.559; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0316222868	T -> C	LOC_Os03g28180-LOC_Os03g28190	intergenic_region ; MODIFIER	silent_mutation	Average:37.559; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0316222868	T -> DEL	N	N	silent_mutation	Average:37.559; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316222868	NA	1.46E-06	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316222868	NA	9.22E-08	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316222868	2.93E-07	3.56E-06	mr1020_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316222868	NA	4.21E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316222868	NA	9.19E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316222868	NA	9.07E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316222868	NA	9.25E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316222868	NA	8.03E-06	mr1786_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251