Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316219278:

Variant ID: vg0316219278 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16219278
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTTATACACTAATCACACTAATCACTACTACTGCTGCTATATATTACTGTTGTACCAAAAATATACAAGTGCATTTGATAAAGGTTGTACAGGTCTG[A/G]
ATCAGAACTGTATATTACTGTTGCACCAAAAATAAATTAATGAACTGTAATTTTCTCTGTATTATTTTTGGATGTGATTACTAAAGCTCGCTATGTGTCT

Reverse complement sequence

AGACACATAGCGAGCTTTAGTAATCACATCCAAAAATAATACAGAGAAAATTACAGTTCATTAATTTATTTTTGGTGCAACAGTAATATACAGTTCTGAT[T/C]
CAGACCTGTACAACCTTTATCAAATGCACTTGTATATTTTTGGTACAACAGTAATATATAGCAGCAGTAGTAGTGATTAGTGTGATTAGTGTATAAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.60%	14.20%	37.71%	15.49%	NA
All Indica	2759	22.30%	2.80%	56.83%	18.01%	NA
All Japonica	1512	57.90%	27.70%	9.06%	5.36%	NA
Aus	269	3.00%	41.30%	12.64%	43.12%	NA
Indica I	595	19.00%	0.20%	55.46%	25.38%	NA
Indica II	465	34.20%	0.60%	52.26%	12.90%	NA
Indica III	913	18.30%	3.40%	61.45%	16.87%	NA
Indica Intermediate	786	22.50%	5.50%	55.22%	16.79%	NA
Temperate Japonica	767	64.30%	26.70%	6.52%	2.48%	NA
Tropical Japonica	504	58.90%	26.00%	8.73%	6.35%	NA
Japonica Intermediate	241	35.30%	34.40%	17.84%	12.45%	NA
VI/Aromatic	96	15.60%	44.80%	11.46%	28.12%	NA
Intermediate	90	32.20%	20.00%	35.56%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316219278	A -> DEL	N	N	silent_mutation	Average:7.124; most accessible tissue: Zhenshan97 flower, score: 18.233	N	N	N	N
vg0316219278	A -> G	LOC_Os03g28170.1	downstream_gene_variant ; 3820.0bp to feature; MODIFIER	silent_mutation	Average:7.124; most accessible tissue: Zhenshan97 flower, score: 18.233	N	N	N	N
vg0316219278	A -> G	LOC_Os03g28175.1	downstream_gene_variant ; 546.0bp to feature; MODIFIER	silent_mutation	Average:7.124; most accessible tissue: Zhenshan97 flower, score: 18.233	N	N	N	N
vg0316219278	A -> G	LOC_Os03g28180.1	downstream_gene_variant ; 1057.0bp to feature; MODIFIER	silent_mutation	Average:7.124; most accessible tissue: Zhenshan97 flower, score: 18.233	N	N	N	N
vg0316219278	A -> G	LOC_Os03g28175-LOC_Os03g28180	intergenic_region ; MODIFIER	silent_mutation	Average:7.124; most accessible tissue: Zhenshan97 flower, score: 18.233	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316219278	NA	7.42E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316219278	8.28E-06	NA	mr1758_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251