RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0316205466:

Variant ID: vg0316205466 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16205466
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAGAGCGCCACGTGGTGACTTAGGAACGTTTATAGGAGTCACATGTGGCGGTTTGAGAGCGTTTGTAGGAAATTTAATGTGCTTTTAATATATAATAA[T/C]
GGATGTTCGATCCATTGTTTCTATTTTCTTAAGAAACCTCGCGAAACATTTACTACTGACAAATGTATATTATTTGTACCATCGTCATCACTTTAATTGG

Reverse complement sequence

CCAATTAAAGTGATGACGATGGTACAAATAATATACATTTGTCAGTAGTAAATGTTTCGCGAGGTTTCTTAAGAAAATAGAAACAATGGATCGAACATCC[A/G]
TTATTATATATTAAAAGCACATTAAATTTCCTACAAACGCTCTCAAACCGCCACATGTGACTCCTATAAACGTTCCTAAGTCACCACGTGGCGCTCTAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	24.10%	0.06%	0.00%	NA
All Indica	2759	98.30%	1.70%	0.04%	0.00%	NA
All Japonica	1512	37.60%	62.30%	0.13%	0.00%	NA
Aus	269	79.90%	20.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	96.80%	3.10%	0.13%	0.00%	NA
Temperate Japonica	767	9.00%	90.90%	0.13%	0.00%	NA
Tropical Japonica	504	70.20%	29.60%	0.20%	0.00%	NA
Japonica Intermediate	241	60.20%	39.80%	0.00%	0.00%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316205466	T -> C	LOC_Os03g28160.2	upstream_gene_variant ; 3668.0bp to feature; MODIFIER	silent_mutation	Average:57.219; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0316205466	T -> C	LOC_Os03g28160.1	upstream_gene_variant ; 3666.0bp to feature; MODIFIER	silent_mutation	Average:57.219; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0316205466	T -> C	LOC_Os03g28140-LOC_Os03g28160	intergenic_region ; MODIFIER	silent_mutation	Average:57.219; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316205466	NA	1.53E-09	mr1063	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316205466	NA	6.07E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316205466	NA	1.27E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0316205466:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact