Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316179400:

Variant ID: vg0316179400 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16179400
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.07, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCCTCCCTCTACCAGTACTCGCATTTGCAGATTTGCTAGTATGCTGTACCTCTAGCACAAATACCACTCTTACTAAGGGCATGTTAAGTTCCCCAAAA[A/G]
GAAAATTTTTAGGTGCCACATCGCATATTTGACCGAATGTTGGAAGAGTTTTCGAATTTCATAACTCGCCTAGAAACCAGGAGACGAATCTTTTGAGCCT

Reverse complement sequence

AGGCTCAAAAGATTCGTCTCCTGGTTTCTAGGCGAGTTATGAAATTCGAAAACTCTTCCAACATTCGGTCAAATATGCGATGTGGCACCTAAAAATTTTC[T/C]
TTTTGGGGAACTTAACATGCCCTTAGTAAGAGTGGTATTTGTGCTAGAGGTACAGCATACTAGCAAATCTGCAAATGCGAGTACTGGTAGAGGGAGGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 42.80% 0.13% 0.00% NA
All Indica  2759 80.10% 19.70% 0.14% 0.00% NA
All Japonica  1512 27.50% 72.40% 0.07% 0.00% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 82.00% 17.80% 0.17% 0.00% NA
Indica II  465 92.00% 8.00% 0.00% 0.00% NA
Indica III  913 75.70% 24.30% 0.00% 0.00% NA
Indica Intermediate  786 76.80% 22.80% 0.38% 0.00% NA
Temperate Japonica  767 3.70% 96.20% 0.13% 0.00% NA
Tropical Japonica  504 65.30% 34.70% 0.00% 0.00% NA
Japonica Intermediate  241 24.50% 75.50% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316179400 A -> G LOC_Os03g28140.1 downstream_gene_variant ; 2622.0bp to feature; MODIFIER silent_mutation Average:85.291; most accessible tissue: Minghui63 panicle, score: 96.84 N N N N
vg0316179400 A -> G LOC_Os03g28130-LOC_Os03g28140 intergenic_region ; MODIFIER silent_mutation Average:85.291; most accessible tissue: Minghui63 panicle, score: 96.84 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0316179400 A G 0.0 -0.01 -0.01 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316179400 NA 7.91E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 NA 2.89E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 NA 1.94E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 NA 6.15E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 NA 7.51E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 4.17E-06 4.17E-06 mr1361 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 NA 9.37E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 NA 7.60E-08 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 NA 1.50E-12 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316179400 NA 7.34E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251