\
| Variant ID: vg0316166709 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 16166709 |
| Reference Allele: T | Alternative Allele: G,TG,TTG,TTTG |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGATGATAAGTTGTTGTATTGAAATATGCCTATCAAAAATAAATTTTTTAGATTTGGAAATATGACTATCAAAAGTAGATGGAGGGAGTTTTTTTTTTTT[T/G,TG,TTG,TTTG]
GGAAAAAACACATCGTTTACTAGTTTGCACTAGTATAGAAATGCACCTATGTGTCGGGTGGGAACCAACCATAAGTACCGAATTTCCTGACCAGTATCAA
TTGATACTGGTCAGGAAATTCGGTACTTATGGTTGGTTCCCACCCGACACATAGGTGCATTTCTATACTAGTGCAAACTAGTAAACGATGTGTTTTTTCC[A/C,CA,CAA,CAAA]
AAAAAAAAAAAACTCCCTCCATCTACTTTTGATAGTCATATTTCCAAATCTAAAAAATTTATTTTTGATAGGCATATTTCAATACAACAACTTATCATCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.10% | 17.10% | 4.40% | 0.00% | TTG: 0.76%; TG: 0.53%; TTTG: 0.04% |
| All Indica | 2759 | 98.50% | 1.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 40.90% | 42.10% | 12.96% | 0.00% | TTG: 2.31%; TG: 1.59%; TTTG: 0.13% |
| Aus | 269 | 81.40% | 16.40% | 1.86% | 0.00% | TG: 0.37% |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 41.20% | 28.60% | 22.43% | 0.00% | TTG: 4.56%; TG: 3.00%; TTTG: 0.26% |
| Tropical Japonica | 504 | 54.60% | 43.10% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 83.00% | 4.98% | 0.00% | TG: 0.41% |
| VI/Aromatic | 96 | 20.80% | 77.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 17.80% | 3.33% | 0.00% | TTG: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316166709 | T -> TTG | LOC_Os03g28110.1 | upstream_gene_variant ; 3578.0bp to feature; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> TTG | LOC_Os03g28130.1 | downstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> TTG | LOC_Os03g28120.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> TTTG | LOC_Os03g28110.1 | upstream_gene_variant ; 3578.0bp to feature; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> TTTG | LOC_Os03g28130.1 | downstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> TTTG | LOC_Os03g28120.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> G | LOC_Os03g28110.1 | upstream_gene_variant ; 3577.0bp to feature; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> G | LOC_Os03g28130.1 | downstream_gene_variant ; 4622.0bp to feature; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> G | LOC_Os03g28120.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> TG | LOC_Os03g28110.1 | upstream_gene_variant ; 3578.0bp to feature; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> TG | LOC_Os03g28130.1 | downstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| vg0316166709 | T -> TG | LOC_Os03g28120.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.159; most accessible tissue: Callus, score: 58.779 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316166709 | NA | 3.36E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316166709 | 2.74E-06 | NA | mr1134_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316166709 | 9.80E-07 | NA | mr1504_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316166709 | 3.74E-06 | NA | mr1672_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316166709 | 3.71E-07 | 3.06E-07 | mr1739_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316166709 | NA | 2.30E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316166709 | 9.71E-07 | 1.28E-06 | mr1887_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316166709 | NA | 2.16E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |