\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316166709:

Variant ID: vg0316166709 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 16166709
Reference Allele: TAlternative Allele: G,TG,TTG,TTTG
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATGATAAGTTGTTGTATTGAAATATGCCTATCAAAAATAAATTTTTTAGATTTGGAAATATGACTATCAAAAGTAGATGGAGGGAGTTTTTTTTTTTT[T/G,TG,TTG,TTTG]
GGAAAAAACACATCGTTTACTAGTTTGCACTAGTATAGAAATGCACCTATGTGTCGGGTGGGAACCAACCATAAGTACCGAATTTCCTGACCAGTATCAA

Reverse complement sequence

TTGATACTGGTCAGGAAATTCGGTACTTATGGTTGGTTCCCACCCGACACATAGGTGCATTTCTATACTAGTGCAAACTAGTAAACGATGTGTTTTTTCC[A/C,CA,CAA,CAAA]
AAAAAAAAAAAACTCCCTCCATCTACTTTTGATAGTCATATTTCCAAATCTAAAAAATTTATTTTTGATAGGCATATTTCAATACAACAACTTATCATCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 17.10% 4.40% 0.00% TTG: 0.76%; TG: 0.53%; TTTG: 0.04%
All Indica  2759 98.50% 1.40% 0.07% 0.00% NA
All Japonica  1512 40.90% 42.10% 12.96% 0.00% TTG: 2.31%; TG: 1.59%; TTTG: 0.13%
Aus  269 81.40% 16.40% 1.86% 0.00% TG: 0.37%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.40% 0.25% 0.00% NA
Temperate Japonica  767 41.20% 28.60% 22.43% 0.00% TTG: 4.56%; TG: 3.00%; TTTG: 0.26%
Tropical Japonica  504 54.60% 43.10% 2.38% 0.00% NA
Japonica Intermediate  241 11.60% 83.00% 4.98% 0.00% TG: 0.41%
VI/Aromatic  96 20.80% 77.10% 2.08% 0.00% NA
Intermediate  90 77.80% 17.80% 3.33% 0.00% TTG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316166709 T -> TTG LOC_Os03g28110.1 upstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> TTG LOC_Os03g28130.1 downstream_gene_variant ; 4621.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> TTG LOC_Os03g28120.1 intron_variant ; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> TTTG LOC_Os03g28110.1 upstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> TTTG LOC_Os03g28130.1 downstream_gene_variant ; 4621.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> TTTG LOC_Os03g28120.1 intron_variant ; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> G LOC_Os03g28110.1 upstream_gene_variant ; 3577.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> G LOC_Os03g28130.1 downstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> G LOC_Os03g28120.1 intron_variant ; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> TG LOC_Os03g28110.1 upstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> TG LOC_Os03g28130.1 downstream_gene_variant ; 4621.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N
vg0316166709 T -> TG LOC_Os03g28120.1 intron_variant ; MODIFIER silent_mutation Average:33.159; most accessible tissue: Callus, score: 58.779 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316166709 NA 3.36E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709 2.74E-06 NA mr1134_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709 9.80E-07 NA mr1504_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709 3.74E-06 NA mr1672_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709 3.71E-07 3.06E-07 mr1739_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709 NA 2.30E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709 9.71E-07 1.28E-06 mr1887_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709 NA 2.16E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251