Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0316166709:

Variant ID: vg0316166709 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 16166709
Reference Allele: T	Alternative Allele: G,TG,TTG,TTTG
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATGATAAGTTGTTGTATTGAAATATGCCTATCAAAAATAAATTTTTTAGATTTGGAAATATGACTATCAAAAGTAGATGGAGGGAGTTTTTTTTTTTT[T/G,TG,TTG,TTTG]
GGAAAAAACACATCGTTTACTAGTTTGCACTAGTATAGAAATGCACCTATGTGTCGGGTGGGAACCAACCATAAGTACCGAATTTCCTGACCAGTATCAA

Reverse complement sequence

TTGATACTGGTCAGGAAATTCGGTACTTATGGTTGGTTCCCACCCGACACATAGGTGCATTTCTATACTAGTGCAAACTAGTAAACGATGTGTTTTTTCC[A/C,CA,CAA,CAAA]
AAAAAAAAAAAACTCCCTCCATCTACTTTTGATAGTCATATTTCCAAATCTAAAAAATTTATTTTTGATAGGCATATTTCAATACAACAACTTATCATCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.10%	17.10%	4.40%	0.00%	TTG: 0.76%; TG: 0.53%; TTTG: 0.04%
All Indica	2759	98.50%	1.40%	0.07%	0.00%	NA
All Japonica	1512	40.90%	42.10%	12.96%	0.00%	TTG: 2.31%; TG: 1.59%; TTTG: 0.13%
Aus	269	81.40%	16.40%	1.86%	0.00%	TG: 0.37%
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.30%	3.40%	0.25%	0.00%	NA
Temperate Japonica	767	41.20%	28.60%	22.43%	0.00%	TTG: 4.56%; TG: 3.00%; TTTG: 0.26%
Tropical Japonica	504	54.60%	43.10%	2.38%	0.00%	NA
Japonica Intermediate	241	11.60%	83.00%	4.98%	0.00%	TG: 0.41%
VI/Aromatic	96	20.80%	77.10%	2.08%	0.00%	NA
Intermediate	90	77.80%	17.80%	3.33%	0.00%	TTG: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316166709	T -> TTG	LOC_Os03g28110.1	upstream_gene_variant ; 3578.0bp to feature; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> TTG	LOC_Os03g28130.1	downstream_gene_variant ; 4621.0bp to feature; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> TTG	LOC_Os03g28120.1	intron_variant ; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> TTTG	LOC_Os03g28110.1	upstream_gene_variant ; 3578.0bp to feature; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> TTTG	LOC_Os03g28130.1	downstream_gene_variant ; 4621.0bp to feature; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> TTTG	LOC_Os03g28120.1	intron_variant ; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> G	LOC_Os03g28110.1	upstream_gene_variant ; 3577.0bp to feature; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> G	LOC_Os03g28130.1	downstream_gene_variant ; 4622.0bp to feature; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> G	LOC_Os03g28120.1	intron_variant ; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> TG	LOC_Os03g28110.1	upstream_gene_variant ; 3578.0bp to feature; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> TG	LOC_Os03g28130.1	downstream_gene_variant ; 4621.0bp to feature; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N
vg0316166709	T -> TG	LOC_Os03g28120.1	intron_variant ; MODIFIER	silent_mutation	Average:33.159; most accessible tissue: Callus, score: 58.779	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316166709	NA	3.36E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709	2.74E-06	NA	mr1134_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709	9.80E-07	NA	mr1504_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709	3.74E-06	NA	mr1672_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709	3.71E-07	3.06E-07	mr1739_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709	NA	2.30E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709	9.71E-07	1.28E-06	mr1887_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316166709	NA	2.16E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251