\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316109457:

Variant ID: vg0316109457 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16109457
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGCATTATTTTCTATTTTAGAAACACATATGTAATGAAAATCAATATTCAGTACGTTTATCAGTAGCCCCAATTCTTAACCCTAACCGGGTTTAAAAA[A/G]
AATTTGGAAATAGCGGGAAAATATCTTTTGTGTTACCAACCGGGACTAAAGATCGATCTTTAGTTCCGGTTATTTCACCCGGGACTAAAGATAGCGATCT

Reverse complement sequence

AGATCGCTATCTTTAGTCCCGGGTGAAATAACCGGAACTAAAGATCGATCTTTAGTCCCGGTTGGTAACACAAAAGATATTTTCCCGCTATTTCCAAATT[T/C]
TTTTTAAACCCGGTTAGGGTTAAGAATTGGGGCTACTGATAAACGTACTGAATATTGATTTTCATTACATATGTGTTTCTAAAATAGAAAATAATGCATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 17.50% 3.75% 5.54% NA
All Indica  2759 82.30% 15.10% 1.12% 1.45% NA
All Japonica  1512 67.40% 19.20% 5.42% 7.94% NA
Aus  269 19.70% 24.50% 21.56% 34.20% NA
Indica I  595 85.50% 14.50% 0.00% 0.00% NA
Indica II  465 92.50% 7.50% 0.00% 0.00% NA
Indica III  913 76.00% 20.20% 2.41% 1.42% NA
Indica Intermediate  786 81.20% 14.20% 1.15% 3.44% NA
Temperate Japonica  767 85.00% 14.30% 0.39% 0.26% NA
Tropical Japonica  504 47.80% 15.10% 14.88% 22.22% NA
Japonica Intermediate  241 52.30% 43.60% 1.66% 2.49% NA
VI/Aromatic  96 60.40% 34.40% 1.04% 4.17% NA
Intermediate  90 67.80% 20.00% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316109457 A -> DEL N N silent_mutation Average:52.161; most accessible tissue: Minghui63 root, score: 70.803 N N N N
vg0316109457 A -> G LOC_Os03g28020.1 downstream_gene_variant ; 777.0bp to feature; MODIFIER silent_mutation Average:52.161; most accessible tissue: Minghui63 root, score: 70.803 N N N N
vg0316109457 A -> G LOC_Os03g28030.1 downstream_gene_variant ; 4146.0bp to feature; MODIFIER silent_mutation Average:52.161; most accessible tissue: Minghui63 root, score: 70.803 N N N N
vg0316109457 A -> G LOC_Os03g28020-LOC_Os03g28030 intergenic_region ; MODIFIER silent_mutation Average:52.161; most accessible tissue: Minghui63 root, score: 70.803 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316109457 NA 1.63E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 1.90E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 8.40E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 1.85E-06 1.85E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 2.50E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 6.83E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 1.50E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 1.23E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 2.93E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 1.99E-06 mr1693_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457 NA 4.91E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251