| Variant ID: vg0316109457 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16109457 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATGCATTATTTTCTATTTTAGAAACACATATGTAATGAAAATCAATATTCAGTACGTTTATCAGTAGCCCCAATTCTTAACCCTAACCGGGTTTAAAAA[A/G]
AATTTGGAAATAGCGGGAAAATATCTTTTGTGTTACCAACCGGGACTAAAGATCGATCTTTAGTTCCGGTTATTTCACCCGGGACTAAAGATAGCGATCT
AGATCGCTATCTTTAGTCCCGGGTGAAATAACCGGAACTAAAGATCGATCTTTAGTCCCGGTTGGTAACACAAAAGATATTTTCCCGCTATTTCCAAATT[T/C]
TTTTTAAACCCGGTTAGGGTTAAGAATTGGGGCTACTGATAAACGTACTGAATATTGATTTTCATTACATATGTGTTTCTAAAATAGAAAATAATGCATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.30% | 17.50% | 3.75% | 5.54% | NA |
| All Indica | 2759 | 82.30% | 15.10% | 1.12% | 1.45% | NA |
| All Japonica | 1512 | 67.40% | 19.20% | 5.42% | 7.94% | NA |
| Aus | 269 | 19.70% | 24.50% | 21.56% | 34.20% | NA |
| Indica I | 595 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.00% | 20.20% | 2.41% | 1.42% | NA |
| Indica Intermediate | 786 | 81.20% | 14.20% | 1.15% | 3.44% | NA |
| Temperate Japonica | 767 | 85.00% | 14.30% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 47.80% | 15.10% | 14.88% | 22.22% | NA |
| Japonica Intermediate | 241 | 52.30% | 43.60% | 1.66% | 2.49% | NA |
| VI/Aromatic | 96 | 60.40% | 34.40% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 67.80% | 20.00% | 5.56% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316109457 | A -> DEL | N | N | silent_mutation | Average:52.161; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg0316109457 | A -> G | LOC_Os03g28020.1 | downstream_gene_variant ; 777.0bp to feature; MODIFIER | silent_mutation | Average:52.161; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg0316109457 | A -> G | LOC_Os03g28030.1 | downstream_gene_variant ; 4146.0bp to feature; MODIFIER | silent_mutation | Average:52.161; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg0316109457 | A -> G | LOC_Os03g28020-LOC_Os03g28030 | intergenic_region ; MODIFIER | silent_mutation | Average:52.161; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316109457 | NA | 1.63E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 1.90E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 8.40E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | 1.85E-06 | 1.85E-06 | mr1065_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 2.50E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 6.83E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 1.50E-07 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 1.23E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 2.93E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 1.99E-06 | mr1693_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316109457 | NA | 4.91E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |