Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0316109457:

Variant ID: vg0316109457 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16109457
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGCATTATTTTCTATTTTAGAAACACATATGTAATGAAAATCAATATTCAGTACGTTTATCAGTAGCCCCAATTCTTAACCCTAACCGGGTTTAAAAA[A/G]
AATTTGGAAATAGCGGGAAAATATCTTTTGTGTTACCAACCGGGACTAAAGATCGATCTTTAGTTCCGGTTATTTCACCCGGGACTAAAGATAGCGATCT

Reverse complement sequence

AGATCGCTATCTTTAGTCCCGGGTGAAATAACCGGAACTAAAGATCGATCTTTAGTCCCGGTTGGTAACACAAAAGATATTTTCCCGCTATTTCCAAATT[T/C]
TTTTTAAACCCGGTTAGGGTTAAGAATTGGGGCTACTGATAAACGTACTGAATATTGATTTTCATTACATATGTGTTTCTAAAATAGAAAATAATGCATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.30%	17.50%	3.75%	5.54%	NA
All Indica	2759	82.30%	15.10%	1.12%	1.45%	NA
All Japonica	1512	67.40%	19.20%	5.42%	7.94%	NA
Aus	269	19.70%	24.50%	21.56%	34.20%	NA
Indica I	595	85.50%	14.50%	0.00%	0.00%	NA
Indica II	465	92.50%	7.50%	0.00%	0.00%	NA
Indica III	913	76.00%	20.20%	2.41%	1.42%	NA
Indica Intermediate	786	81.20%	14.20%	1.15%	3.44%	NA
Temperate Japonica	767	85.00%	14.30%	0.39%	0.26%	NA
Tropical Japonica	504	47.80%	15.10%	14.88%	22.22%	NA
Japonica Intermediate	241	52.30%	43.60%	1.66%	2.49%	NA
VI/Aromatic	96	60.40%	34.40%	1.04%	4.17%	NA
Intermediate	90	67.80%	20.00%	5.56%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316109457	A -> DEL	N	N	silent_mutation	Average:52.161; most accessible tissue: Minghui63 root, score: 70.803	N	N	N	N
vg0316109457	A -> G	LOC_Os03g28020.1	downstream_gene_variant ; 777.0bp to feature; MODIFIER	silent_mutation	Average:52.161; most accessible tissue: Minghui63 root, score: 70.803	N	N	N	N
vg0316109457	A -> G	LOC_Os03g28030.1	downstream_gene_variant ; 4146.0bp to feature; MODIFIER	silent_mutation	Average:52.161; most accessible tissue: Minghui63 root, score: 70.803	N	N	N	N
vg0316109457	A -> G	LOC_Os03g28020-LOC_Os03g28030	intergenic_region ; MODIFIER	silent_mutation	Average:52.161; most accessible tissue: Minghui63 root, score: 70.803	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316109457	NA	1.63E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	1.90E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	8.40E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	1.85E-06	1.85E-06	mr1065_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	2.50E-06	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	6.83E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	1.50E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	1.23E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	2.93E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	1.99E-06	mr1693_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316109457	NA	4.91E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251