\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316092122:

Variant ID: vg0316092122 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16092122
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGAAATCTTAGTCTGAGAGAAAATGCACCTGCTGACAAAAAAAAGGGAGACAGATATAGCTGCATTTTTCACGACCTACCGTGCATTGAAAAAAAAAA[T/A]
GAGAATTAGCTAGGGTTCGTACTGATGGTTGCTGGTGGTTACTAGACTATCAAGTTTGTTGGTGTCTTGAACTTCTTCGTTTCTGTGGCTCCATTACTGA

Reverse complement sequence

TCAGTAATGGAGCCACAGAAACGAAGAAGTTCAAGACACCAACAAACTTGATAGTCTAGTAACCACCAGCAACCATCAGTACGAACCCTAGCTAATTCTC[A/T]
TTTTTTTTTTCAATGCACGGTAGGTCGTGAAAAATGCAGCTATATCTGTCTCCCTTTTTTTTGTCAGCAGGTGCATTTTCTCTCAGACTAAGATTTCACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 15.10% 0.49% 0.00% NA
All Indica  2759 96.90% 3.00% 0.04% 0.00% NA
All Japonica  1512 71.70% 27.00% 1.32% 0.00% NA
Aus  269 33.80% 66.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 95.50% 4.50% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.50% 0.13% 0.00% NA
Temperate Japonica  767 92.30% 6.00% 1.69% 0.00% NA
Tropical Japonica  504 48.60% 51.20% 0.20% 0.00% NA
Japonica Intermediate  241 54.40% 43.20% 2.49% 0.00% NA
VI/Aromatic  96 69.80% 29.20% 1.04% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316092122 T -> A LOC_Os03g28000.1 upstream_gene_variant ; 3632.0bp to feature; MODIFIER silent_mutation Average:52.304; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N
vg0316092122 T -> A LOC_Os03g28010.1 upstream_gene_variant ; 1149.0bp to feature; MODIFIER silent_mutation Average:52.304; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N
vg0316092122 T -> A LOC_Os03g28000-LOC_Os03g28010 intergenic_region ; MODIFIER silent_mutation Average:52.304; most accessible tissue: Zhenshan97 root, score: 77.09 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316092122 6.19E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 2.21E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 2.22E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 3.44E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 2.59E-06 2.59E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 1.55E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 1.29E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 1.28E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 4.30E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 9.56E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 2.97E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 3.27E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 6.71E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 2.36E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 2.44E-06 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 2.30E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 5.07E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 NA 2.14E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122 3.79E-06 NA mr1961_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251