Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316092122:

Variant ID: vg0316092122 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16092122
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGAAATCTTAGTCTGAGAGAAAATGCACCTGCTGACAAAAAAAAGGGAGACAGATATAGCTGCATTTTTCACGACCTACCGTGCATTGAAAAAAAAAA[T/A]
GAGAATTAGCTAGGGTTCGTACTGATGGTTGCTGGTGGTTACTAGACTATCAAGTTTGTTGGTGTCTTGAACTTCTTCGTTTCTGTGGCTCCATTACTGA

Reverse complement sequence

TCAGTAATGGAGCCACAGAAACGAAGAAGTTCAAGACACCAACAAACTTGATAGTCTAGTAACCACCAGCAACCATCAGTACGAACCCTAGCTAATTCTC[A/T]
TTTTTTTTTTCAATGCACGGTAGGTCGTGAAAAATGCAGCTATATCTGTCTCCCTTTTTTTTGTCAGCAGGTGCATTTTCTCTCAGACTAAGATTTCACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	15.10%	0.49%	0.00%	NA
All Indica	2759	96.90%	3.00%	0.04%	0.00%	NA
All Japonica	1512	71.70%	27.00%	1.32%	0.00%	NA
Aus	269	33.80%	66.20%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	95.50%	4.50%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.50%	0.13%	0.00%	NA
Temperate Japonica	767	92.30%	6.00%	1.69%	0.00%	NA
Tropical Japonica	504	48.60%	51.20%	0.20%	0.00%	NA
Japonica Intermediate	241	54.40%	43.20%	2.49%	0.00%	NA
VI/Aromatic	96	69.80%	29.20%	1.04%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316092122	T -> A	LOC_Os03g28000.1	upstream_gene_variant ; 3632.0bp to feature; MODIFIER	silent_mutation	Average:52.304; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0316092122	T -> A	LOC_Os03g28010.1	upstream_gene_variant ; 1149.0bp to feature; MODIFIER	silent_mutation	Average:52.304; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0316092122	T -> A	LOC_Os03g28000-LOC_Os03g28010	intergenic_region ; MODIFIER	silent_mutation	Average:52.304; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316092122	6.19E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	2.21E-06	NA	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	2.22E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	3.44E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	2.59E-06	2.59E-06	mr1065_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	1.55E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	1.29E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	1.28E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	4.30E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	9.56E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	2.97E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	3.27E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	6.71E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	2.36E-07	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	2.44E-06	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	2.30E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	5.07E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	NA	2.14E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316092122	3.79E-06	NA	mr1961_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251