\
| Variant ID: vg0316049074 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16049074 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATCTCCTATCTCTTCTCATCTCTCTCTATATTCTCTCTCAGAGGCGTGCTCACACGGGGAGGCATCGGTCGCGGCGGAGATGGCGAGGACGGCGGCCAG[C/T]
GGAGTGAAGCGGGGCAGCAGCGGCGGTGGACGAGCGCACGGCCGGCGGAGCGGCATCATCGGCCGAGCAGAGTGGCAGCAGTGGCGAGCGAGCGCGCGGC
GCCGCGCGCTCGCTCGCCACTGCTGCCACTCTGCTCGGCCGATGATGCCGCTCCGCCGGCCGTGCGCTCGTCCACCGCCGCTGCTGCCCCGCTTCACTCC[G/A]
CTGGCCGCCGTCCTCGCCATCTCCGCCGCGACCGATGCCTCCCCGTGTGAGCACGCCTCTGAGAGAGAATATAGAGAGAGATGAGAAGAGATAGGAGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 10.40% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 70.60% | 28.20% | 1.19% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 70.30% | 27.80% | 1.96% | 0.00% | NA |
| Tropical Japonica | 504 | 69.80% | 29.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 26.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 61.50% | 38.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316049074 | C -> T | LOC_Os03g27940.1 | missense_variant ; p.Arg43Trp; MODERATE | nonsynonymous_codon ; R43W | Average:75.717; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316049074 | 6.02E-06 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316049074 | NA | 2.37E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316049074 | NA | 8.47E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316049074 | 8.40E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316049074 | 2.09E-07 | NA | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316049074 | NA | 9.37E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316049074 | 3.40E-06 | NA | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |