\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316048632:

Variant ID: vg0316048632 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16048632
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATGTGCTAATGATTACTTTGCCACGTGTATCTTTTGTGGCCATAGCTTCAATGTGCAGAGATATATAAATATTCCTGTTGAATGCCCTACACTCAAT[G/T]
AAATGACATCTGGTTATTAATAAGTAAGGGCAACTTGGTAATTTTTTTCTTTAAGCTAATTTGCTTCTGAAACCTTAAATCATCATGCTTTGTGGGATGG

Reverse complement sequence

CCATCCCACAAAGCATGATGATTTAAGGTTTCAGAAGCAAATTAGCTTAAAGAAAAAAATTACCAAGTTGCCCTTACTTATTAATAACCAGATGTCATTT[C/A]
ATTGAGTGTAGGGCATTCAACAGGAATATTTATATATCTCTGCACATTGAAGCTATGGCCACAAAAGATACACGTGGCAAAGTAATCATTAGCACATTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.70% 0.30% 0.00% NA
All Indica  2759 83.00% 16.70% 0.29% 0.00% NA
All Japonica  1512 13.80% 86.00% 0.20% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 87.40% 12.40% 0.17% 0.00% NA
Indica II  465 92.90% 6.90% 0.22% 0.00% NA
Indica III  913 77.00% 22.70% 0.33% 0.00% NA
Indica Intermediate  786 80.70% 19.00% 0.38% 0.00% NA
Temperate Japonica  767 3.40% 96.50% 0.13% 0.00% NA
Tropical Japonica  504 26.20% 73.40% 0.40% 0.00% NA
Japonica Intermediate  241 21.20% 78.80% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 48.90% 47.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316048632 G -> T LOC_Os03g27940.1 upstream_gene_variant ; 316.0bp to feature; MODIFIER silent_mutation Average:48.705; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0316048632 G -> T LOC_Os03g27950.1 upstream_gene_variant ; 2628.0bp to feature; MODIFIER silent_mutation Average:48.705; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0316048632 G -> T LOC_Os03g27950.2 upstream_gene_variant ; 2628.0bp to feature; MODIFIER silent_mutation Average:48.705; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0316048632 G -> T LOC_Os03g27930.1 downstream_gene_variant ; 3094.0bp to feature; MODIFIER silent_mutation Average:48.705; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0316048632 G -> T LOC_Os03g27930-LOC_Os03g27940 intergenic_region ; MODIFIER silent_mutation Average:48.705; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316048632 NA 2.82E-09 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 8.27E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 2.45E-10 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 2.39E-10 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.08E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.19E-18 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 6.97E-18 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 3.66E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 5.95E-15 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 4.56E-24 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 9.44E-31 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.72E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 3.86E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 7.89E-16 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.29E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 2.39E-12 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 3.52E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 4.36E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 3.05E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 2.40E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 4.72E-06 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 5.07E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.18E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 8.00E-06 mr1636 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 4.39E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 2.39E-14 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 2.40E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 9.35E-19 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 3.43E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 2.47E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.22E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.72E-08 mr1727 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.82E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.71E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.19E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 3.11E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 3.18E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.14E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 1.11E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316048632 NA 2.39E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251