\
| Variant ID: vg0316037703 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 16037703 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 313. )
TCTTATGGATTCCATGACATCGGACCTCCAGCCGATGTGTGCTTTAACCTTCGGATCAATGCTTATTTATCATATCATTATTTGCCGATTGGTTTATACT[G/A]
GATTATATTGTTATTTTATTATATCATCATCAGTCGATTGCCTTTATATCATTATCTACATTGGACATATAGCCGATTGCTTAAACCCTATCGCTATCGG
CCGATAGCGATAGGGTTTAAGCAATCGGCTATATGTCCAATGTAGATAATGATATAAAGGCAATCGACTGATGATGATATAATAAAATAACAATATAATC[C/T]
AGTATAAACCAATCGGCAAATAATGATATGATAAATAAGCATTGATCCGAAGGTTAAAGCACACATCGGCTGGAGGTCCGATGTCATGGAATCCATAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 4.00% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 89.40% | 9.90% | 0.66% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.90% | 5.60% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 5.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 64.70% | 33.20% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0316037703 | G -> A | LOC_Os03g27920.1 | upstream_gene_variant ; 3235.0bp to feature; MODIFIER | silent_mutation | Average:39.508; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg0316037703 | G -> A | LOC_Os03g27930.1 | upstream_gene_variant ; 1290.0bp to feature; MODIFIER | silent_mutation | Average:39.508; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg0316037703 | G -> A | LOC_Os03g27920-LOC_Os03g27930 | intergenic_region ; MODIFIER | silent_mutation | Average:39.508; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0316037703 | NA | 1.76E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316037703 | 4.39E-06 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316037703 | 3.15E-06 | 3.15E-06 | mr1065_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316037703 | NA | 9.16E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0316037703 | NA | 1.51E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |