\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316037703:

Variant ID: vg0316037703 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16037703
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTATGGATTCCATGACATCGGACCTCCAGCCGATGTGTGCTTTAACCTTCGGATCAATGCTTATTTATCATATCATTATTTGCCGATTGGTTTATACT[G/A]
GATTATATTGTTATTTTATTATATCATCATCAGTCGATTGCCTTTATATCATTATCTACATTGGACATATAGCCGATTGCTTAAACCCTATCGCTATCGG

Reverse complement sequence

CCGATAGCGATAGGGTTTAAGCAATCGGCTATATGTCCAATGTAGATAATGATATAAAGGCAATCGACTGATGATGATATAATAAAATAACAATATAATC[C/T]
AGTATAAACCAATCGGCAAATAATGATATGATAAATAAGCATTGATCCGAAGGTTAAAGCACACATCGGCTGGAGGTCCGATGTCATGGAATCCATAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 4.00% 0.21% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 89.40% 9.90% 0.66% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 93.90% 5.60% 0.52% 0.00% NA
Tropical Japonica  504 94.40% 5.40% 0.20% 0.00% NA
Japonica Intermediate  241 64.70% 33.20% 2.07% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316037703 G -> A LOC_Os03g27920.1 upstream_gene_variant ; 3235.0bp to feature; MODIFIER silent_mutation Average:39.508; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0316037703 G -> A LOC_Os03g27930.1 upstream_gene_variant ; 1290.0bp to feature; MODIFIER silent_mutation Average:39.508; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg0316037703 G -> A LOC_Os03g27920-LOC_Os03g27930 intergenic_region ; MODIFIER silent_mutation Average:39.508; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316037703 NA 1.76E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316037703 4.39E-06 NA mr1023_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316037703 3.15E-06 3.15E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316037703 NA 9.16E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316037703 NA 1.51E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251