\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316019263:

Variant ID: vg0316019263 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 16019263
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCTCTTCCATATATCTTCTCACTTCAAGCAGATCATCCAAATTACATCCTCCATATCACATCCTTCTATATTTTAGTAATATCTTCCAACTAACTTTA[C/T]
ATTTGTATATGTATTTGAAGAGATATATTTTGAATGACTTAATTTAACAGTGTTATTTATCATGATAATATTTCGAAATGAATAAATTTTAACGGATATA

Reverse complement sequence

TATATCCGTTAAAATTTATTCATTTCGAAATATTATCATGATAAATAACACTGTTAAATTAAGTCATTCAAAATATATCTCTTCAAATACATATACAAAT[G/A]
TAAAGTTAGTTGGAAGATATTACTAAAATATAGAAGGATGTGATATGGAGGATGTAATTTGGATGATCTGCTTGAAGTGAGAAGATATATGGAAGAGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 0.30% 23.72% 16.86% NA
All Indica  2759 37.00% 0.20% 36.50% 26.35% NA
All Japonica  1512 90.30% 0.30% 5.49% 3.84% NA
Aus  269 98.10% 1.10% 0.74% 0.00% NA
Indica I  595 23.90% 0.00% 42.35% 33.78% NA
Indica II  465 33.30% 0.40% 42.80% 23.44% NA
Indica III  913 47.30% 0.00% 27.49% 25.19% NA
Indica Intermediate  786 37.00% 0.40% 38.80% 23.79% NA
Temperate Japonica  767 97.90% 0.00% 1.17% 0.91% NA
Tropical Japonica  504 79.80% 1.00% 12.10% 7.14% NA
Japonica Intermediate  241 88.40% 0.00% 5.39% 6.22% NA
VI/Aromatic  96 85.40% 3.10% 8.33% 3.12% NA
Intermediate  90 66.70% 0.00% 23.33% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0316019263 C -> T LOC_Os03g27870.1 upstream_gene_variant ; 4051.0bp to feature; MODIFIER silent_mutation Average:61.901; most accessible tissue: Callus, score: 83.16 N N N N
vg0316019263 C -> T LOC_Os03g27880.1 upstream_gene_variant ; 524.0bp to feature; MODIFIER silent_mutation Average:61.901; most accessible tissue: Callus, score: 83.16 N N N N
vg0316019263 C -> T LOC_Os03g27890.1 upstream_gene_variant ; 427.0bp to feature; MODIFIER silent_mutation Average:61.901; most accessible tissue: Callus, score: 83.16 N N N N
vg0316019263 C -> T LOC_Os03g27880-LOC_Os03g27890 intergenic_region ; MODIFIER silent_mutation Average:61.901; most accessible tissue: Callus, score: 83.16 N N N N
vg0316019263 C -> DEL N N silent_mutation Average:61.901; most accessible tissue: Callus, score: 83.16 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0316019263 NA 5.14E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.59E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.43E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 4.94E-08 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 2.76E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 5.82E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.78E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.38E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 4.53E-08 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.23E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 2.52E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.76E-08 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 2.65E-07 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 9.80E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.59E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.71E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 8.33E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.72E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.22E-07 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 3.41E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 2.18E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 3.52E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.97E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 8.79E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.99E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 2.41E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.15E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 6.52E-06 NA mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.37E-12 mr1939 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 3.69E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 1.10E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263 NA 2.44E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251