Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0316019263:

Variant ID: vg0316019263 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 16019263
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCTCTTCCATATATCTTCTCACTTCAAGCAGATCATCCAAATTACATCCTCCATATCACATCCTTCTATATTTTAGTAATATCTTCCAACTAACTTTA[C/T]
ATTTGTATATGTATTTGAAGAGATATATTTTGAATGACTTAATTTAACAGTGTTATTTATCATGATAATATTTCGAAATGAATAAATTTTAACGGATATA

Reverse complement sequence

TATATCCGTTAAAATTTATTCATTTCGAAATATTATCATGATAAATAACACTGTTAAATTAAGTCATTCAAAATATATCTCTTCAAATACATATACAAAT[G/A]
TAAAGTTAGTTGGAAGATATTACTAAAATATAGAAGGATGTGATATGGAGGATGTAATTTGGATGATCTGCTTGAAGTGAGAAGATATATGGAAGAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	0.30%	23.72%	16.86%	NA
All Indica	2759	37.00%	0.20%	36.50%	26.35%	NA
All Japonica	1512	90.30%	0.30%	5.49%	3.84%	NA
Aus	269	98.10%	1.10%	0.74%	0.00%	NA
Indica I	595	23.90%	0.00%	42.35%	33.78%	NA
Indica II	465	33.30%	0.40%	42.80%	23.44%	NA
Indica III	913	47.30%	0.00%	27.49%	25.19%	NA
Indica Intermediate	786	37.00%	0.40%	38.80%	23.79%	NA
Temperate Japonica	767	97.90%	0.00%	1.17%	0.91%	NA
Tropical Japonica	504	79.80%	1.00%	12.10%	7.14%	NA
Japonica Intermediate	241	88.40%	0.00%	5.39%	6.22%	NA
VI/Aromatic	96	85.40%	3.10%	8.33%	3.12%	NA
Intermediate	90	66.70%	0.00%	23.33%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0316019263	C -> T	LOC_Os03g27870.1	upstream_gene_variant ; 4051.0bp to feature; MODIFIER	silent_mutation	Average:61.901; most accessible tissue: Callus, score: 83.16	N	N	N	N
vg0316019263	C -> T	LOC_Os03g27880.1	upstream_gene_variant ; 524.0bp to feature; MODIFIER	silent_mutation	Average:61.901; most accessible tissue: Callus, score: 83.16	N	N	N	N
vg0316019263	C -> T	LOC_Os03g27890.1	upstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:61.901; most accessible tissue: Callus, score: 83.16	N	N	N	N
vg0316019263	C -> T	LOC_Os03g27880-LOC_Os03g27890	intergenic_region ; MODIFIER	silent_mutation	Average:61.901; most accessible tissue: Callus, score: 83.16	N	N	N	N
vg0316019263	C -> DEL	N	N	silent_mutation	Average:61.901; most accessible tissue: Callus, score: 83.16	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0316019263	NA	5.14E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.59E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.43E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	4.94E-08	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	2.76E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	5.82E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.78E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.38E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	4.53E-08	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.23E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	2.52E-06	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.76E-08	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	2.65E-07	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	9.80E-07	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.59E-06	mr1434	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.71E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	8.33E-07	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.72E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.22E-07	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	3.41E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	2.18E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	3.52E-07	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.97E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	8.79E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.99E-06	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	2.41E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.15E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	6.52E-06	NA	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.37E-12	mr1939	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	3.69E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	1.10E-06	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0316019263	NA	2.44E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251