\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315932136:

Variant ID: vg0315932136 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15932136
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTAAATGGATGTGACACATACTTGTAAAATGAATCTGGACAGACCGTCACATCCACCCAAAATCTCTTATATTTCCTTTGTCCCATTTTAAGTGCAGC[C/T]
ATGGTTTTTCGTGTCCAACTTTGACCGTCCGTCTTATTTAAAAAAATAAAAAATAAGTTACGAGTAAAGTCCAATTCATGTTTTATTATCTCATTACAAC

Reverse complement sequence

GTTGTAATGAGATAATAAAACATGAATTGGACTTTACTCGTAACTTATTTTTTATTTTTTTAAATAAGACGGACGGTCAAAGTTGGACACGAAAAACCAT[G/A]
GCTGCACTTAAAATGGGACAAAGGAAATATAAGAGATTTTGGGTGGATGTGACGGTCTGTCCAGATTCATTTTACAAGTATGTGTCACATCCATTTAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 8.20% 0.06% 0.00% NA
All Indica  2759 87.00% 12.90% 0.07% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 89.20% 10.80% 0.00% 0.00% NA
Indica II  465 89.00% 10.50% 0.43% 0.00% NA
Indica III  913 81.90% 18.10% 0.00% 0.00% NA
Indica Intermediate  786 89.90% 10.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315932136 C -> T LOC_Os03g27770.1 upstream_gene_variant ; 4702.0bp to feature; MODIFIER silent_mutation Average:64.133; most accessible tissue: Zhenshan97 flower, score: 86.702 N N N N
vg0315932136 C -> T LOC_Os03g27780.1 upstream_gene_variant ; 388.0bp to feature; MODIFIER silent_mutation Average:64.133; most accessible tissue: Zhenshan97 flower, score: 86.702 N N N N
vg0315932136 C -> T LOC_Os03g27780.2 upstream_gene_variant ; 388.0bp to feature; MODIFIER silent_mutation Average:64.133; most accessible tissue: Zhenshan97 flower, score: 86.702 N N N N
vg0315932136 C -> T LOC_Os03g27790.1 downstream_gene_variant ; 4911.0bp to feature; MODIFIER silent_mutation Average:64.133; most accessible tissue: Zhenshan97 flower, score: 86.702 N N N N
vg0315932136 C -> T LOC_Os03g27770-LOC_Os03g27780 intergenic_region ; MODIFIER silent_mutation Average:64.133; most accessible tissue: Zhenshan97 flower, score: 86.702 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315932136 NA 9.51E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315932136 3.57E-06 NA mr1198_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315932136 NA 3.80E-06 mr1552_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251