\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315930935:

Variant ID: vg0315930935 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15930935
Reference Allele: AAlternative Allele: T,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATATATATGTGTAAGGATTTGTTCCCACAATCTCTATTTTACCGAAATAACATATCTACAAGTTACACTATAGTTATAGTGTAATTACATGCAAGTT[A/T,C]
CAGTGTAATTACACTACGATTGTACTGTAATTACATCTGTTAAATTTTTGGGAGAAAATTTATCGACAAATATATAGCAAAATCGTTTAAGTGTGGCCTA

Reverse complement sequence

TAGGCCACACTTAAACGATTTTGCTATATATTTGTCGATAAATTTTCTCCCAAAAATTTAACAGATGTAATTACAGTACAATCGTAGTGTAATTACACTG[T/A,G]
AACTTGCATGTAATTACACTATAACTATAGTGTAACTTGTAGATATGTTATTTCGGTAAAATAGAGATTGTGGGAACAAATCCTTACACATATATATGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 7.90% 0.15% 0.00% C: 0.08%
All Indica  2759 93.00% 6.80% 0.14% 0.00% NA
All Japonica  1512 89.30% 10.30% 0.13% 0.00% C: 0.26%
Aus  269 90.70% 8.90% 0.37% 0.00% NA
Indica I  595 89.20% 10.60% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 93.50% 6.40% 0.11% 0.00% NA
Indica Intermediate  786 92.00% 7.80% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 70.40% 28.60% 0.20% 0.00% C: 0.79%
Japonica Intermediate  241 95.40% 4.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315930935 A -> T LOC_Os03g27770.1 upstream_gene_variant ; 3501.0bp to feature; MODIFIER silent_mutation Average:37.423; most accessible tissue: Callus, score: 61.143 N N N N
vg0315930935 A -> T LOC_Os03g27780.1 upstream_gene_variant ; 1589.0bp to feature; MODIFIER silent_mutation Average:37.423; most accessible tissue: Callus, score: 61.143 N N N N
vg0315930935 A -> T LOC_Os03g27780.2 upstream_gene_variant ; 1589.0bp to feature; MODIFIER silent_mutation Average:37.423; most accessible tissue: Callus, score: 61.143 N N N N
vg0315930935 A -> T LOC_Os03g27770-LOC_Os03g27780 intergenic_region ; MODIFIER silent_mutation Average:37.423; most accessible tissue: Callus, score: 61.143 N N N N
vg0315930935 A -> C LOC_Os03g27770.1 upstream_gene_variant ; 3501.0bp to feature; MODIFIER silent_mutation Average:37.423; most accessible tissue: Callus, score: 61.143 N N N N
vg0315930935 A -> C LOC_Os03g27780.1 upstream_gene_variant ; 1589.0bp to feature; MODIFIER silent_mutation Average:37.423; most accessible tissue: Callus, score: 61.143 N N N N
vg0315930935 A -> C LOC_Os03g27780.2 upstream_gene_variant ; 1589.0bp to feature; MODIFIER silent_mutation Average:37.423; most accessible tissue: Callus, score: 61.143 N N N N
vg0315930935 A -> C LOC_Os03g27770-LOC_Os03g27780 intergenic_region ; MODIFIER silent_mutation Average:37.423; most accessible tissue: Callus, score: 61.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315930935 NA 1.64E-07 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315930935 NA 7.08E-08 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315930935 NA 1.44E-09 mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251