Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0315920143:

Variant ID: vg0315920143 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15920143
Reference Allele: GAlternative Allele: C,A
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAAGAACCTTTCCGTGGAACGTGGCGTAGTTGGCTCGCGTTAGGCCGATGGATCACATGTGGATCGCGTTAGGGATTCATATAAATATAAATGTTAAT[G/C,A]
AATATAGATATCTAATGCTAGAAAATTTTACATTGTAAAACGGAAAGTATATACTCTCTCCGTCTAAAAAAAGACAAACCCTGGTTTTCGTGTCCAACGT

Reverse complement sequence

ACGTTGGACACGAAAACCAGGGTTTGTCTTTTTTTAGACGGAGAGAGTATATACTTTCCGTTTTACAATGTAAAATTTTCTAGCATTAGATATCTATATT[C/G,T]
ATTAACATTTATATTTATATGAATCCCTAACGCGATCCACATGTGATCCATCGGCCTAACGCGAGCCAACTACGCCACGTTCCACGGAAAGGTTCTTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.80% 0.06% 0.00% A: 0.02%
All Indica  2759 92.60% 7.30% 0.07% 0.00% NA
All Japonica  1512 25.50% 74.50% 0.00% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 91.10% 8.90% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 91.60% 8.40% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.50% 0.25% 0.00% NA
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 56.50% 43.50% 0.00% 0.00% NA
Japonica Intermediate  241 27.00% 73.00% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 77.10% 0.00% 0.00% A: 1.04%
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315920143 G -> C LOC_Os03g27770.1 downstream_gene_variant ; 3730.0bp to feature; MODIFIER silent_mutation Average:59.443; most accessible tissue: Zhenshan97 flower, score: 84.504 N N N N
vg0315920143 G -> C LOC_Os03g27760-LOC_Os03g27770 intergenic_region ; MODIFIER silent_mutation Average:59.443; most accessible tissue: Zhenshan97 flower, score: 84.504 N N N N
vg0315920143 G -> A LOC_Os03g27770.1 downstream_gene_variant ; 3730.0bp to feature; MODIFIER silent_mutation Average:59.443; most accessible tissue: Zhenshan97 flower, score: 84.504 N N N N
vg0315920143 G -> A LOC_Os03g27760-LOC_Os03g27770 intergenic_region ; MODIFIER silent_mutation Average:59.443; most accessible tissue: Zhenshan97 flower, score: 84.504 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315920143 G A 0.01 -0.01 -0.02 -0.02 -0.05 -0.04
vg0315920143 G C 0.04 -0.02 -0.02 -0.01 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315920143 NA 2.98E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 4.52E-06 3.59E-07 mr1138 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 1.11E-14 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 1.07E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 9.37E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 5.96E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 2.90E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 3.35E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 1.20E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 3.05E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 3.85E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 3.86E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 2.88E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315920143 NA 2.82E-07 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251