| Variant ID: vg0315905274 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15905274 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 126. )
GGTCGCCGGAACCTCTGCCTTCGACGTCCTGCACCGGGAGAAGGCAGCAATAAGGTTTTTGGAAAGCGCTTCGCGCGACTGCTTCCTGTTTGTCCGCAAC[A/G]
GCTCGCCTTCCTCTCCGCTCGCGTGCTGCGCGCCTTCGTCGACGCTCGCAACCGCGAGTAGTTCCTGCCGAGCAACCGGTCTTTCCGCCACCTCGGTACG
CGTACCGAGGTGGCGGAAAGACCGGTTGCTCGGCAGGAACTACTCGCGGTTGCGAGCGTCGACGAAGGCGCGCAGCACGCGAGCGGAGAGGAAGGCGAGC[T/C]
GTTGCGGACAAACAGGAAGCAGTCGCGCGAAGCGCTTTCCAAAAACCTTATTGCTGCCTTCTCCCGGTGCAGGACGTCGAAGGCAGAGGTTCCGGCGACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 29.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 90.40% | 9.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 33.00% | 67.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315905274 | A -> G | LOC_Os03g27750.1 | upstream_gene_variant ; 311.0bp to feature; MODIFIER | silent_mutation | Average:67.448; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0315905274 | A -> G | LOC_Os03g27740.1 | downstream_gene_variant ; 3181.0bp to feature; MODIFIER | silent_mutation | Average:67.448; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0315905274 | A -> G | LOC_Os03g27760.1 | downstream_gene_variant ; 2757.0bp to feature; MODIFIER | silent_mutation | Average:67.448; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0315905274 | A -> G | LOC_Os03g27740-LOC_Os03g27750 | intergenic_region ; MODIFIER | silent_mutation | Average:67.448; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315905274 | NA | 1.23E-13 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0315905274 | NA | 4.15E-06 | mr1042 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315905274 | NA | 2.33E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315905274 | NA | 2.38E-09 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315905274 | NA | 7.78E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315905274 | NA | 1.83E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315905274 | NA | 9.76E-07 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315905274 | NA | 9.80E-11 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315905274 | NA | 1.90E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315905274 | NA | 1.88E-21 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/