\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315903149:

Variant ID: vg0315903149 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15903149
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CCATGAGCCCATGAGGCAGCTGGAGGATTTTGACAGCAACACAAGCAATGTGCTCTTTTGCTTCGAGAGATTTTGGTTGGATGAGACATATATAAATCTG[G/A]
ATATGATCTTTGTTCAGATTCGTGATATTAGAATGTGTCTCATCCAACTAAAATTCTTTATGTTAATTTTACGACTGAGGGAATATAGTACTGCGATCTC

Reverse complement sequence

GAGATCGCAGTACTATATTCCCTCAGTCGTAAAATTAACATAAAGAATTTTAGTTGGATGAGACACATTCTAATATCACGAATCTGAACAAAGATCATAT[C/T]
CAGATTTATATATGTCTCATCCAACCAAAATCTCTCGAAGCAAAAGAGCACATTGCTTGTGTTGCTGTCAAAATCCTCCAGCTGCCTCATGGGCTCATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 37.10% 0.40% 0.00% NA
All Indica  2759 88.80% 10.80% 0.43% 0.00% NA
All Japonica  1512 22.20% 77.50% 0.26% 0.00% NA
Aus  269 34.90% 65.10% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 88.60% 10.50% 0.86% 0.00% NA
Indica III  913 78.90% 20.70% 0.44% 0.00% NA
Indica Intermediate  786 92.40% 7.10% 0.51% 0.00% NA
Temperate Japonica  767 4.40% 95.40% 0.13% 0.00% NA
Tropical Japonica  504 48.00% 51.40% 0.60% 0.00% NA
Japonica Intermediate  241 24.90% 75.10% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 63.30% 33.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315903149 G -> A LOC_Os03g27750.1 upstream_gene_variant ; 2436.0bp to feature; MODIFIER silent_mutation Average:52.069; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0315903149 G -> A LOC_Os03g27740.1 downstream_gene_variant ; 1056.0bp to feature; MODIFIER silent_mutation Average:52.069; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0315903149 G -> A LOC_Os03g27760.1 downstream_gene_variant ; 4882.0bp to feature; MODIFIER silent_mutation Average:52.069; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0315903149 G -> A LOC_Os03g27740-LOC_Os03g27750 intergenic_region ; MODIFIER silent_mutation Average:52.069; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315903149 NA 3.01E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 2.77E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 8.86E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 1.29E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 1.70E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 1.21E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 7.79E-36 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 3.61E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 1.69E-07 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 9.18E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 4.35E-06 NA mr1301_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 2.45E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315903149 NA 5.89E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251