\
| Variant ID: vg0315903149 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15903149 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 222. )
CCATGAGCCCATGAGGCAGCTGGAGGATTTTGACAGCAACACAAGCAATGTGCTCTTTTGCTTCGAGAGATTTTGGTTGGATGAGACATATATAAATCTG[G/A]
ATATGATCTTTGTTCAGATTCGTGATATTAGAATGTGTCTCATCCAACTAAAATTCTTTATGTTAATTTTACGACTGAGGGAATATAGTACTGCGATCTC
GAGATCGCAGTACTATATTCCCTCAGTCGTAAAATTAACATAAAGAATTTTAGTTGGATGAGACACATTCTAATATCACGAATCTGAACAAAGATCATAT[C/T]
CAGATTTATATATGTCTCATCCAACCAAAATCTCTCGAAGCAAAAGAGCACATTGCTTGTGTTGCTGTCAAAATCCTCCAGCTGCCTCATGGGCTCATGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 37.10% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 88.80% | 10.80% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 22.20% | 77.50% | 0.26% | 0.00% | NA |
| Aus | 269 | 34.90% | 65.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.60% | 10.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 78.90% | 20.70% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 7.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 4.40% | 95.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 51.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.90% | 75.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 33.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315903149 | G -> A | LOC_Os03g27750.1 | upstream_gene_variant ; 2436.0bp to feature; MODIFIER | silent_mutation | Average:52.069; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0315903149 | G -> A | LOC_Os03g27740.1 | downstream_gene_variant ; 1056.0bp to feature; MODIFIER | silent_mutation | Average:52.069; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0315903149 | G -> A | LOC_Os03g27760.1 | downstream_gene_variant ; 4882.0bp to feature; MODIFIER | silent_mutation | Average:52.069; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0315903149 | G -> A | LOC_Os03g27740-LOC_Os03g27750 | intergenic_region ; MODIFIER | silent_mutation | Average:52.069; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315903149 | NA | 3.01E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 2.77E-08 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 8.86E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 1.29E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 1.70E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 1.21E-14 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 7.79E-36 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 3.61E-06 | mr1227_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 1.69E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 9.18E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | 4.35E-06 | NA | mr1301_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 2.45E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315903149 | NA | 5.89E-06 | mr1733_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |