Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315837144:

Variant ID: vg0315837144 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15837144
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCCACAAAAGTAACTGATCACCTCGAATTCGATCTCCTCTCTTCGATCTCTGCATTATTTGATTTGATTGGGGATTGTGGGCGGCGTGGCGTGGCGT[C/G]
CAGGAGGTGCGGCATGGCGGCGGCCATGGCGGCGCTGACGAGGCCGAGGTACAACGGCAAGTACCTGCAGGGGAAGATCAGGAAGATGCTGGGCGAGACG

Reverse complement sequence

CGTCTCGCCCAGCATCTTCCTGATCTTCCCCTGCAGGTACTTGCCGTTGTACCTCGGCCTCGTCAGCGCCGCCATGGCCGCCGCCATGCCGCACCTCCTG[G/C]
ACGCCACGCCACGCCGCCCACAATCCCCAATCAAATCAAATAATGCAGAGATCGAAGAGAGGAGATCGAATTCGAGGTGATCAGTTACTTTTGTGGGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 17.80% 2.22% 0.00% NA
All Indica  2759 91.30% 8.60% 0.14% 0.00% NA
All Japonica  1512 58.20% 35.40% 6.35% 0.00% NA
Aus  269 91.80% 7.80% 0.37% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 89.20% 10.30% 0.43% 0.00% NA
Indica III  913 83.80% 16.10% 0.11% 0.00% NA
Indica Intermediate  786 94.80% 5.20% 0.00% 0.00% NA
Temperate Japonica  767 37.70% 51.40% 10.95% 0.00% NA
Tropical Japonica  504 89.70% 9.30% 0.99% 0.00% NA
Japonica Intermediate  241 57.70% 39.40% 2.90% 0.00% NA
VI/Aromatic  96 60.40% 37.50% 2.08% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315837144 C -> G LOC_Os03g27610.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:79.024; most accessible tissue: Zhenshan97 young leaf, score: 91.76 N N N N
vg0315837144 C -> G LOC_Os03g27630.1 downstream_gene_variant ; 4755.0bp to feature; MODIFIER silent_mutation Average:79.024; most accessible tissue: Zhenshan97 young leaf, score: 91.76 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315837144 C G -0.03 -0.03 -0.04 -0.02 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315837144 NA 9.40E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 3.93E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 8.66E-09 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 6.30E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 1.16E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 2.99E-06 mr1502 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 5.55E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 4.36E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 1.94E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 1.79E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 1.56E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 1.57E-08 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 3.17E-07 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 3.26E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315837144 NA 4.77E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251