\
| Variant ID: vg0315818553 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15818553 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 32. )
TGGCCTTTTCCTTCTAATTGGTTCAGATTGATGCAATTTGTTTCATACTTACTATGAATAAGGTCTTGTTTAGTTGGAAAAAAATTTTGGTTTTGGTTGT[C/T]
ACATCGGATATACGGACACACATTTGAAGTATTAAACGTAGTCTAATAACAAAACAAATTATAGATTCCGTCAGAAAACTGCGAGACAAATTTATTAAGC
GCTTAATAAATTTGTCTCGCAGTTTTCTGACGGAATCTATAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTGTGTCCGTATATCCGATGT[G/A]
ACAACCAAAACCAAAATTTTTTTCCAACTAAACAAGACCTTATTCATAGTAAGTATGAAACAAATTGCATCAATCTGAACCAATTAGAAGGAAAAGGCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.10% | 8.30% | 6.88% | 50.72% | NA |
| All Indica | 2759 | 11.30% | 11.80% | 7.58% | 69.26% | NA |
| All Japonica | 1512 | 67.10% | 4.00% | 7.34% | 21.56% | NA |
| Aus | 269 | 63.20% | 0.40% | 0.74% | 35.69% | NA |
| Indica I | 595 | 2.20% | 7.60% | 5.88% | 84.37% | NA |
| Indica II | 465 | 12.70% | 7.30% | 4.09% | 75.91% | NA |
| Indica III | 913 | 19.50% | 18.50% | 11.61% | 50.38% | NA |
| Indica Intermediate | 786 | 8.00% | 9.90% | 6.23% | 75.83% | NA |
| Temperate Japonica | 767 | 96.00% | 0.30% | 0.91% | 2.87% | NA |
| Tropical Japonica | 504 | 21.40% | 8.70% | 17.46% | 52.38% | NA |
| Japonica Intermediate | 241 | 71.00% | 5.80% | 6.64% | 16.60% | NA |
| VI/Aromatic | 96 | 80.20% | 1.00% | 1.04% | 17.71% | NA |
| Intermediate | 90 | 38.90% | 6.70% | 2.22% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315818553 | C -> T | LOC_Os03g27580-LOC_Os03g27590 | intergenic_region ; MODIFIER | silent_mutation | Average:18.218; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0315818553 | C -> DEL | N | N | silent_mutation | Average:18.218; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315818553 | 5.56E-06 | 6.50E-17 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0315818553 | 4.68E-06 | 1.48E-06 | mr1324 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | NA | 9.47E-06 | mr1325 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | 3.35E-06 | 2.04E-06 | mr1335 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | NA | 7.42E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | NA | 1.90E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | NA | 1.19E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | NA | 5.10E-08 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | NA | 1.35E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | 4.65E-06 | NA | mr1064_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | NA | 4.33E-08 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315818553 | NA | 1.51E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |