Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315818548:

Variant ID: vg0315818548 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15818548
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGATGGCCTTTTCCTTCTAATTGGTTCAGATTGATGCAATTTGTTTCATACTTACTATGAATAAGGTCTTGTTTAGTTGGAAAAAAATTTTGGTTTTG[G/A]
TTGTCACATCGGATATACGGACACACATTTGAAGTATTAAACGTAGTCTAATAACAAAACAAATTATAGATTCCGTCAGAAAACTGCGAGACAAATTTAT

Reverse complement sequence

ATAAATTTGTCTCGCAGTTTTCTGACGGAATCTATAATTTGTTTTGTTATTAGACTACGTTTAATACTTCAAATGTGTGTCCGTATATCCGATGTGACAA[C/T]
CAAAACCAAAATTTTTTTCCAACTAAACAAGACCTTATTCATAGTAAGTATGAAACAAATTGCATCAATCTGAACCAATTAGAAGGAAAAGGCCATCCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.90%	7.10%	7.00%	51.97%	NA
All Indica	2759	11.20%	10.30%	8.05%	70.53%	NA
All Japonica	1512	67.10%	3.20%	6.68%	23.08%	NA
Aus	269	63.20%	0.00%	1.12%	35.69%	NA
Indica I	595	2.20%	5.90%	6.72%	85.21%	NA
Indica II	465	12.30%	7.10%	3.44%	77.20%	NA
Indica III	913	19.40%	16.10%	12.16%	52.35%	NA
Indica Intermediate	786	7.80%	8.70%	7.00%	76.59%	NA
Temperate Japonica	767	96.00%	0.30%	0.91%	2.87%	NA
Tropical Japonica	504	21.40%	6.30%	15.67%	56.55%	NA
Japonica Intermediate	241	70.50%	5.80%	6.22%	17.43%	NA
VI/Aromatic	96	80.20%	1.00%	1.04%	17.71%	NA
Intermediate	90	37.80%	4.40%	4.44%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315818548	G -> A	LOC_Os03g27580-LOC_Os03g27590	intergenic_region ; MODIFIER	silent_mutation	Average:18.461; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0315818548	G -> DEL	N	N	silent_mutation	Average:18.461; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315818548	NA	4.73E-17	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315818548	NA	3.17E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	3.91E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	3.55E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	1.34E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	1.01E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	3.79E-06	NA	mr1590	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	3.79E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	7.63E-09	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	4.14E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	7.44E-08	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	9.76E-06	9.76E-06	mr1964	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	9.48E-06	mr1027_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	1.21E-07	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	5.86E-16	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	2.91E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	4.53E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	1.09E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	5.09E-07	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	1.14E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315818548	NA	1.67E-13	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251