\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315769551:

Variant ID: vg0315769551 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15769551
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.34, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CTATATTTATCTACAAACTTGGTCAAACTTAGAGTAGTTTGATTTTTACCCAACGACTTATAATATGAAAAGTAAGAAGTAATAAATTTGGAGGCTACTT[T/C]
ATGTTTATTTATTTGTTAAATACATAGGGATTTATCTAACTGGCTATAGATTGGATTATGCTACTGATCATTATAAAACTCAGATGCGAGCCTGCTTACA

Reverse complement sequence

TGTAAGCAGGCTCGCATCTGAGTTTTATAATGATCAGTAGCATAATCCAATCTATAGCCAGTTAGATAAATCCCTATGTATTTAACAAATAAATAAACAT[A/G]
AAGTAGCCTCCAAATTTATTACTTCTTACTTTTCATATTATAAGTCGTTGGGTAAAAATCAAACTACTCTAAGTTTGACCAAGTTTGTAGATAAATATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.10% 0.25% 0.00% NA
All Indica  2759 91.80% 7.80% 0.33% 0.00% NA
All Japonica  1512 25.40% 74.60% 0.00% 0.00% NA
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 90.80% 8.40% 0.86% 0.00% NA
Indica III  913 84.90% 15.00% 0.11% 0.00% NA
Indica Intermediate  786 94.90% 4.80% 0.25% 0.00% NA
Temperate Japonica  767 4.60% 95.40% 0.00% 0.00% NA
Tropical Japonica  504 56.90% 43.10% 0.00% 0.00% NA
Japonica Intermediate  241 25.70% 74.30% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 78.10% 1.04% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315769551 T -> C LOC_Os03g27480.1 upstream_gene_variant ; 2238.0bp to feature; MODIFIER silent_mutation Average:38.872; most accessible tissue: Callus, score: 82.393 N N N N
vg0315769551 T -> C LOC_Os03g27490.1 upstream_gene_variant ; 4640.0bp to feature; MODIFIER silent_mutation Average:38.872; most accessible tissue: Callus, score: 82.393 N N N N
vg0315769551 T -> C LOC_Os03g27480.2 upstream_gene_variant ; 2241.0bp to feature; MODIFIER silent_mutation Average:38.872; most accessible tissue: Callus, score: 82.393 N N N N
vg0315769551 T -> C LOC_Os03g27484.1 downstream_gene_variant ; 910.0bp to feature; MODIFIER silent_mutation Average:38.872; most accessible tissue: Callus, score: 82.393 N N N N
vg0315769551 T -> C LOC_Os03g27480-LOC_Os03g27484 intergenic_region ; MODIFIER silent_mutation Average:38.872; most accessible tissue: Callus, score: 82.393 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315769551 NA 1.11E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.58E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.10E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 2.20E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.29E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.49E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 3.75E-07 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.57E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 7.45E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 8.10E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 3.54E-09 mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.85E-06 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 2.85E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.21E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 4.18E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.83E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 7.16E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.39E-09 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.33E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 5.20E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 9.36E-08 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 3.36E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 3.52E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.76E-06 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 NA 1.71E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315769551 3.47E-06 1.10E-08 mr1733_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251