\
| Variant ID: vg0315741484 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15741484 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGCTACTAATGTATAATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATATCAGATTTTAGTTATTTGTAAATTATATTCCTAT[A/T]
TAGACTCTAGAATTGTCCTTCAATATTTATTTTTTTTTAATTTTGAATTTTCGTTATCTGTAAATTGTATTTCATATAGACTCTAGGCTCTTCTTCCAAT
ATTGGAAGAAGAGCCTAGAGTCTATATGAAATACAATTTACAGATAACGAAAATTCAAAATTAAAAAAAAATAAATATTGAAGGACAATTCTAGAGTCTA[T/A]
ATAGGAATATAATTTACAAATAACTAAAATCTGATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATTATACATTAGTAGCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 4.60% | 0.49% | 0.04% | NA |
| All Indica | 2759 | 97.90% | 2.00% | 0.07% | 0.07% | NA |
| All Japonica | 1512 | 98.70% | 0.10% | 1.26% | 0.00% | NA |
| Aus | 269 | 43.90% | 56.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.22% | 0.22% | NA |
| Indica III | 913 | 96.50% | 3.30% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 0.00% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315741484 | A -> T | LOC_Os03g27430.1 | upstream_gene_variant ; 652.0bp to feature; MODIFIER | silent_mutation | Average:24.874; most accessible tissue: Callus, score: 39.716 | N | N | N | N |
| vg0315741484 | A -> T | LOC_Os03g27440.1 | upstream_gene_variant ; 3817.0bp to feature; MODIFIER | silent_mutation | Average:24.874; most accessible tissue: Callus, score: 39.716 | N | N | N | N |
| vg0315741484 | A -> T | LOC_Os03g27430-LOC_Os03g27440 | intergenic_region ; MODIFIER | silent_mutation | Average:24.874; most accessible tissue: Callus, score: 39.716 | N | N | N | N |
| vg0315741484 | A -> DEL | N | N | silent_mutation | Average:24.874; most accessible tissue: Callus, score: 39.716 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315741484 | NA | 1.20E-06 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315741484 | NA | 4.25E-08 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315741484 | NA | 3.75E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315741484 | NA | 8.11E-10 | mr1942_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |