\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315741484:

Variant ID: vg0315741484 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15741484
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGCTACTAATGTATAATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATATCAGATTTTAGTTATTTGTAAATTATATTCCTAT[A/T]
TAGACTCTAGAATTGTCCTTCAATATTTATTTTTTTTTAATTTTGAATTTTCGTTATCTGTAAATTGTATTTCATATAGACTCTAGGCTCTTCTTCCAAT

Reverse complement sequence

ATTGGAAGAAGAGCCTAGAGTCTATATGAAATACAATTTACAGATAACGAAAATTCAAAATTAAAAAAAAATAAATATTGAAGGACAATTCTAGAGTCTA[T/A]
ATAGGAATATAATTTACAAATAACTAAAATCTGATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATTATACATTAGTAGCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 4.60% 0.49% 0.04% NA
All Indica  2759 97.90% 2.00% 0.07% 0.07% NA
All Japonica  1512 98.70% 0.10% 1.26% 0.00% NA
Aus  269 43.90% 56.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.00% 0.22% 0.22% NA
Indica III  913 96.50% 3.30% 0.11% 0.11% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 0.00% 2.35% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315741484 A -> T LOC_Os03g27430.1 upstream_gene_variant ; 652.0bp to feature; MODIFIER silent_mutation Average:24.874; most accessible tissue: Callus, score: 39.716 N N N N
vg0315741484 A -> T LOC_Os03g27440.1 upstream_gene_variant ; 3817.0bp to feature; MODIFIER silent_mutation Average:24.874; most accessible tissue: Callus, score: 39.716 N N N N
vg0315741484 A -> T LOC_Os03g27430-LOC_Os03g27440 intergenic_region ; MODIFIER silent_mutation Average:24.874; most accessible tissue: Callus, score: 39.716 N N N N
vg0315741484 A -> DEL N N silent_mutation Average:24.874; most accessible tissue: Callus, score: 39.716 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315741484 NA 1.20E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315741484 NA 4.25E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315741484 NA 3.75E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315741484 NA 8.11E-10 mr1942_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251