Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315681712:

Variant ID: vg0315681712 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15681712
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACAACGGCTTTTTAGCCGTTGTAGAGTAGCACAATCTGACTGGCCACACACCTCCGGTCAGACCGGCAGTACACCGAGTTGGGGGATTTCGCCCCCAA[T/C]
GTCTAGTTTTGGTGGGTGGGAGTATAAATACTCCCCCACCAGCAGCAAGGGGACTCTCTTTGCACCCACTTCAATTGCACCTCTCCCACACTCATTTGAG

Reverse complement sequence

CTCAAATGAGTGTGGGAGAGGTGCAATTGAAGTGGGTGCAAAGAGAGTCCCCTTGCTGCTGGTGGGGGAGTATTTATACTCCCACCCACCAAAACTAGAC[A/G]
TTGGGGGCGAAATCCCCCAACTCGGTGTACTGCCGGTCTGACCGGAGGTGTGTGGCCAGTCAGATTGTGCTACTCTACAACGGCTAAAAAGCCGTTGTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.90%	25.90%	0.17%	0.00%	NA
All Indica	2759	97.10%	2.80%	0.18%	0.00%	NA
All Japonica	1512	33.30%	66.60%	0.07%	0.00%	NA
Aus	269	81.80%	18.20%	0.00%	0.00%	NA
Indica I	595	99.30%	0.30%	0.34%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	97.00%	2.70%	0.22%	0.00%	NA
Indica Intermediate	786	94.10%	5.70%	0.13%	0.00%	NA
Temperate Japonica	767	4.30%	95.70%	0.00%	0.00%	NA
Tropical Japonica	504	79.40%	20.40%	0.20%	0.00%	NA
Japonica Intermediate	241	29.50%	70.50%	0.00%	0.00%	NA
VI/Aromatic	96	24.00%	75.00%	1.04%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315681712	T -> C	LOC_Os03g27370.1	downstream_gene_variant ; 2498.0bp to feature; MODIFIER	silent_mutation	Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0315681712	T -> C	LOC_Os03g27380.1	downstream_gene_variant ; 993.0bp to feature; MODIFIER	silent_mutation	Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0315681712	T -> C	LOC_Os03g27390.1	downstream_gene_variant ; 3830.0bp to feature; MODIFIER	silent_mutation	Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0315681712	T -> C	LOC_Os03g27390.2	downstream_gene_variant ; 3830.0bp to feature; MODIFIER	silent_mutation	Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0315681712	T -> C	LOC_Os03g27370-LOC_Os03g27380	intergenic_region ; MODIFIER	silent_mutation	Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315681712	NA	6.13E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	3.75E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	1.56E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	1.51E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	2.09E-08	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	1.92E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	7.35E-08	mr1138_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	3.19E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	5.24E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	3.59E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	2.72E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	2.10E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712	NA	2.16E-11	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251