\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315681712:

Variant ID: vg0315681712 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15681712
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACAACGGCTTTTTAGCCGTTGTAGAGTAGCACAATCTGACTGGCCACACACCTCCGGTCAGACCGGCAGTACACCGAGTTGGGGGATTTCGCCCCCAA[T/C]
GTCTAGTTTTGGTGGGTGGGAGTATAAATACTCCCCCACCAGCAGCAAGGGGACTCTCTTTGCACCCACTTCAATTGCACCTCTCCCACACTCATTTGAG

Reverse complement sequence

CTCAAATGAGTGTGGGAGAGGTGCAATTGAAGTGGGTGCAAAGAGAGTCCCCTTGCTGCTGGTGGGGGAGTATTTATACTCCCACCCACCAAAACTAGAC[A/G]
TTGGGGGCGAAATCCCCCAACTCGGTGTACTGCCGGTCTGACCGGAGGTGTGTGGCCAGTCAGATTGTGCTACTCTACAACGGCTAAAAAGCCGTTGTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 25.90% 0.17% 0.00% NA
All Indica  2759 97.10% 2.80% 0.18% 0.00% NA
All Japonica  1512 33.30% 66.60% 0.07% 0.00% NA
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 97.00% 2.70% 0.22% 0.00% NA
Indica Intermediate  786 94.10% 5.70% 0.13% 0.00% NA
Temperate Japonica  767 4.30% 95.70% 0.00% 0.00% NA
Tropical Japonica  504 79.40% 20.40% 0.20% 0.00% NA
Japonica Intermediate  241 29.50% 70.50% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 75.00% 1.04% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315681712 T -> C LOC_Os03g27370.1 downstream_gene_variant ; 2498.0bp to feature; MODIFIER silent_mutation Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0315681712 T -> C LOC_Os03g27380.1 downstream_gene_variant ; 993.0bp to feature; MODIFIER silent_mutation Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0315681712 T -> C LOC_Os03g27390.1 downstream_gene_variant ; 3830.0bp to feature; MODIFIER silent_mutation Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0315681712 T -> C LOC_Os03g27390.2 downstream_gene_variant ; 3830.0bp to feature; MODIFIER silent_mutation Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0315681712 T -> C LOC_Os03g27370-LOC_Os03g27380 intergenic_region ; MODIFIER silent_mutation Average:65.941; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315681712 NA 6.13E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 3.75E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 1.56E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 1.51E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 2.09E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 1.92E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 7.35E-08 mr1138_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 3.19E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 5.24E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 3.59E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 2.72E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 2.10E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315681712 NA 2.16E-11 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251