\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315675411:

Variant ID: vg0315675411 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 15675411
Reference Allele: AAlternative Allele: T,AT
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATAAATTTGTCTCGCAGTTTACATGCGGAATTTGTAATTTGTTTTATTATTAGTCTATATTTAGTTCTTCAAATGTGTGTCCGTATACTTAAAAAAAA[A/T,AT]
TTGACTGTGGAATTAAACACGGCCTACGTATTTGAGAAAACATTGATGGTCAGAATTTTAAAAGCATGACTGAATTATATCCTGAATGTCAAATATTTTT

Reverse complement sequence

AAAAATATTTGACATTCAGGATATAATTCAGTCATGCTTTTAAAATTCTGACCATCAATGTTTTCTCAAATACGTAGGCCGTGTTTAATTCCACAGTCAA[T/A,AT]
TTTTTTTTAAGTATACGGACACACATTTGAAGAACTAAATATAGACTAATAATAAAACAAATTACAAATTCCGCATGTAAACTGCGAGACAAATTTATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.20% 0.02% 0.00% AT: 0.66%
All Indica  2759 96.00% 3.20% 0.00% 0.00% AT: 0.80%
All Japonica  1512 32.70% 66.70% 0.07% 0.00% AT: 0.53%
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 99.00% 0.30% 0.00% 0.00% AT: 0.67%
Indica II  465 98.10% 0.90% 0.00% 0.00% AT: 1.08%
Indica III  913 95.10% 3.90% 0.00% 0.00% AT: 0.99%
Indica Intermediate  786 93.80% 5.70% 0.00% 0.00% AT: 0.51%
Temperate Japonica  767 4.30% 95.70% 0.00% 0.00% NA
Tropical Japonica  504 77.20% 21.00% 0.20% 0.00% AT: 1.59%
Japonica Intermediate  241 29.90% 70.10% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 0.00% 0.00% AT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315675411 A -> T LOC_Os03g27370.1 intron_variant ; MODIFIER silent_mutation Average:37.631; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0315675411 A -> AT LOC_Os03g27370.1 intron_variant ; MODIFIER silent_mutation Average:37.631; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315675411 NA 7.49E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315675411 NA 1.57E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 9.49E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 4.51E-10 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 1.94E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 3.34E-10 mr1733 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 4.46E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 1.60E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 1.03E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 1.82E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 5.60E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 8.10E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 6.37E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315675411 NA 2.47E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251