\
| Variant ID: vg0315675411 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 15675411 |
| Reference Allele: A | Alternative Allele: T,AT |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATAAATTTGTCTCGCAGTTTACATGCGGAATTTGTAATTTGTTTTATTATTAGTCTATATTTAGTTCTTCAAATGTGTGTCCGTATACTTAAAAAAAA[A/T,AT]
TTGACTGTGGAATTAAACACGGCCTACGTATTTGAGAAAACATTGATGGTCAGAATTTTAAAAGCATGACTGAATTATATCCTGAATGTCAAATATTTTT
AAAAATATTTGACATTCAGGATATAATTCAGTCATGCTTTTAAAATTCTGACCATCAATGTTTTCTCAAATACGTAGGCCGTGTTTAATTCCACAGTCAA[T/A,AT]
TTTTTTTTAAGTATACGGACACACATTTGAAGAACTAAATATAGACTAATAATAAAACAAATTACAAATTCCGCATGTAAACTGCGAGACAAATTTATTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 26.20% | 0.02% | 0.00% | AT: 0.66% |
| All Indica | 2759 | 96.00% | 3.20% | 0.00% | 0.00% | AT: 0.80% |
| All Japonica | 1512 | 32.70% | 66.70% | 0.07% | 0.00% | AT: 0.53% |
| Aus | 269 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.30% | 0.00% | 0.00% | AT: 0.67% |
| Indica II | 465 | 98.10% | 0.90% | 0.00% | 0.00% | AT: 1.08% |
| Indica III | 913 | 95.10% | 3.90% | 0.00% | 0.00% | AT: 0.99% |
| Indica Intermediate | 786 | 93.80% | 5.70% | 0.00% | 0.00% | AT: 0.51% |
| Temperate Japonica | 767 | 4.30% | 95.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.20% | 21.00% | 0.20% | 0.00% | AT: 1.59% |
| Japonica Intermediate | 241 | 29.90% | 70.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 0.00% | 0.00% | AT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315675411 | A -> T | LOC_Os03g27370.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.631; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0315675411 | A -> AT | LOC_Os03g27370.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.631; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315675411 | NA | 7.49E-14 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0315675411 | NA | 1.57E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 9.49E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 4.51E-10 | mr1679 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 1.94E-06 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 3.34E-10 | mr1733 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 4.46E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 1.60E-06 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 1.03E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 1.82E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 5.60E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 8.10E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 6.37E-10 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315675411 | NA | 2.47E-12 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |