\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315621163:

Variant ID: vg0315621163 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15621163
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:


CGGATGACGATGATACATTGAATTGTTGATCTCCTCTGTTTGCAGGTGCTACTGCATACTTCACGAGGACAACGTCCTGGGAGCCATATTTAGCCTGTGG[A/G]
AGGATCTGGGCACCGCGACGTCATGGGAAGATGTTGAACACTTGGTTTGGGGAGAGCTGAATCAATACCAGCAGTCATGCAGCGTGGGCGAAATTAACTG

Reverse complement sequence

CAGTTAATTTCGCCCACGCTGCATGACTGCTGGTATTGATTCAGCTCTCCCCAAACCAAGTGTTCAACATCTTCCCATGACGTCGCGGTGCCCAGATCCT[T/C]
CCACAGGCTAAATATGGCTCCCAGGACGTTGTCCTCGTGAAGTATGCAGTAGCACCTGCAAACAGAGGAGATCAACAATTCAATGTATCATCGTCATCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 5.10% 0.89% 0.00% NA
All Indica  2759 98.40% 1.30% 0.22% 0.00% NA
All Japonica  1512 84.50% 13.20% 2.31% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.40% 2.40% 0.22% 0.00% NA
Indica Intermediate  786 97.60% 1.90% 0.51% 0.00% NA
Temperate Japonica  767 88.50% 8.50% 3.00% 0.00% NA
Tropical Japonica  504 88.70% 10.90% 0.40% 0.00% NA
Japonica Intermediate  241 62.70% 33.20% 4.15% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315621163 A -> G LOC_Os03g27250.1 missense_variant ; p.Lys921Glu; MODERATE nonsynonymous_codon ; K921E Average:85.539; most accessible tissue: Minghui63 flower, score: 91.346 benign 1.256 TOLERATED 0.33

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315621163 A G -0.01 0.01 0.0 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315621163 NA 5.26E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315621163 NA 5.81E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315621163 NA 2.30E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315621163 NA 1.11E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315621163 NA 3.00E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315621163 NA 5.26E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315621163 NA 8.44E-06 mr1492_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315621163 NA 2.16E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251