Variant ID: vg0315592194 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 15592194 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 227. )
ATGATAAGTAGAATTACTTATTCTTGGTCCATGTGTCAAGATGAAATATGACTATCAAAAGTAGATGGAGGGAGTATTTGTGATCTCTCACGACGTTCGA[A/C]
GATGTGAATCATCTTCGTAGTATATTGGCAGGTTCAATTAATATAGTATCTGTGTCTTATTTCTACGTTTCAACAGAATAGTTCCTTGTGTTTAATACAA
TTGTATTAAACACAAGGAACTATTCTGTTGAAACGTAGAAATAAGACACAGATACTATATTAATTGAACCTGCCAATATACTACGAAGATGATTCACATC[T/G]
TCGAACGTCGTGAGAGATCACAAATACTCCCTCCATCTACTTTTGATAGTCATATTTCATCTTGACACATGGACCAAGAATAAGTAATTCTACTTATCAT
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.60% | 0.80% | 0.59% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 95.80% | 2.40% | 1.79% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 91.90% | 4.80% | 3.26% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0315592194 | A -> C | LOC_Os03g27210-LOC_Os03g27230 | intergenic_region ; MODIFIER | silent_mutation | Average:56.972; most accessible tissue: Callus, score: 84.909 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0315592194 | 3.58E-06 | 1.19E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0315592194 | 2.16E-06 | 1.19E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0315592194 | NA | 6.54E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0315592194 | 2.94E-07 | 1.84E-11 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0315592194 | 1.11E-06 | 3.73E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0315592194 | 6.28E-06 | 3.45E-08 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0315592194 | 5.05E-07 | 4.80E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0315592194 | NA | 6.87E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0315592194 | 4.62E-08 | 9.59E-12 | mr1585_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |