\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315388478:

Variant ID: vg0315388478 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 15388478
Reference Allele: ATGAlternative Allele: GTG,A
Primary Allele: GTGSecondary Allele: ATG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGGCCATTTCGCACACCACGTCGTCTCCCCCATCTTCCATCTCCTCGCAACGTACTCCCTCCGTAAAAGAAAAAAAAAAGAGACAAACCCTAATTTTT[ATG/GTG,A]
TCTAATGTTTGACCGTCCGTCTTATTTAAAAAAATTATAAAAAAAATTAAAAAAATAAGTCACGCATAAAGTATTAATCATGTTTTATCATCTAACAATA

Reverse complement sequence

TATTGTTAGATGATAAAACATGATTAATACTTTATGCGTGACTTATTTTTTTAATTTTTTTTATAATTTTTTTAAATAAGACGGACGGTCAAACATTAGA[CAT/CAC,T]
AAAAATTAGGGTTTGTCTCTTTTTTTTTTCTTTTACGGAGGGAGTACGTTGCGAGGAGATGGAAGATGGGGGAGACGACGTGGTGTGCGAAATGGCCTCT

Allele Frequencies:

Populations Population SizeFrequency of GTG(primary allele) Frequency of ATG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 17.90% 10.39% 10.56% A: 5.90%
All Indica  2759 70.50% 0.20% 13.52% 15.59% A: 0.22%
All Japonica  1512 20.50% 54.60% 3.57% 3.70% A: 17.59%
Aus  269 81.80% 0.40% 17.47% 0.37% NA
Indica I  595 81.80% 0.20% 11.43% 6.55% NA
Indica II  465 75.30% 0.20% 11.61% 12.90% NA
Indica III  913 67.80% 0.10% 10.95% 20.59% A: 0.55%
Indica Intermediate  786 62.10% 0.40% 19.21% 18.19% A: 0.13%
Temperate Japonica  767 9.30% 85.40% 1.96% 0.52% A: 2.87%
Tropical Japonica  504 35.50% 10.90% 7.14% 9.72% A: 36.71%
Japonica Intermediate  241 24.90% 48.10% 1.24% 1.24% A: 24.48%
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 51.10% 14.40% 13.33% 13.33% A: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315388478 ATG -> GTG LOC_Os03g26910.1 downstream_gene_variant ; 4204.0bp to feature; MODIFIER silent_mutation Average:87.928; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0315388478 ATG -> GTG LOC_Os03g26910-LOC_Os03g26920 intergenic_region ; MODIFIER silent_mutation Average:87.928; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0315388478 ATG -> A LOC_Os03g26910.1 downstream_gene_variant ; 4205.0bp to feature; MODIFIER silent_mutation Average:87.928; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0315388478 ATG -> A LOC_Os03g26910-LOC_Os03g26920 intergenic_region ; MODIFIER silent_mutation Average:87.928; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg0315388478 ATG -> DEL N N silent_mutation Average:87.928; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0315388478 ATG A 0.15 -0.05 0.02 -0.15 -0.08 0.13
vg0315388478 ATG GTG -0.07 -0.05 -0.02 -0.01 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315388478 NA 1.27E-33 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0315388478 NA 1.20E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 3.10E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 8.10E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 1.66E-07 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 1.22E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 6.42E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 9.95E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 2.94E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 3.10E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 4.44E-19 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 8.11E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 4.61E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 5.27E-16 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.27E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.05E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.48E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.48E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 3.26E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.76E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 3.70E-23 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 2.43E-23 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.35E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 1.85E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 4.83E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 3.98E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.15E-28 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.23E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 1.62E-09 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 7.26E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 6.01E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 5.69E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 8.17E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 4.24E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 4.01E-07 NA mr1849_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 2.88E-14 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 2.64E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 3.34E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 2.61E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 1.29E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 4.43E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 3.45E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 1.38E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 1.71E-19 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315388478 NA 6.60E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251