\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315359335:

Variant ID: vg0315359335 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15359335
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGATAAGATCGGCTGAAACTCCGATACTACCCTAATCGGCAACCAGAAGGCAGGTTAGAGATTGGTATTCTAAGCACGACTTAATAGATCAAACTCAA[C/A]
TGATGCAGCATTAAGTATGAAAAGAAGAACAATATCTAGACAATCAAGTCGCTGGAAGTTTCATAGAGTGGTAGATATCTTACATAATCTAAATCAACGT

Reverse complement sequence

ACGTTGATTTAGATTATGTAAGATATCTACCACTCTATGAAACTTCCAGCGACTTGATTGTCTAGATATTGTTCTTCTTTTCATACTTAATGCTGCATCA[G/T]
TTGAGTTTGATCTATTAAGTCGTGCTTAGAATACCAATCTCTAACCTGCCTTCTGGTTGCCGATTAGGGTAGTATCGGAGTTTCAGCCGATCTTATCTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 9.00% 3.20% 0.00% NA
All Indica  2759 92.40% 4.50% 3.15% 0.00% NA
All Japonica  1512 90.90% 8.60% 0.53% 0.00% NA
Aus  269 22.30% 58.40% 19.33% 0.00% NA
Indica I  595 94.10% 2.40% 3.53% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 89.80% 7.30% 2.85% 0.00% NA
Indica Intermediate  786 89.60% 5.30% 5.09% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 74.40% 24.00% 1.59% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315359335 C -> A LOC_Os03g26890.1 upstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg0315359335 C -> A LOC_Os03g26900.1 upstream_gene_variant ; 738.0bp to feature; MODIFIER silent_mutation Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N
vg0315359335 C -> A LOC_Os03g26900-LOC_Os03g26910 intergenic_region ; MODIFIER silent_mutation Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315359335 8.25E-06 NA mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 NA 4.38E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 NA 3.16E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 NA 3.51E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 NA 7.60E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 NA 9.02E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 NA 9.05E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 NA 4.17E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 3.72E-06 1.46E-07 mr1948 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315359335 5.30E-06 5.30E-06 mr1314_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251