\
| Variant ID: vg0315359335 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15359335 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 254. )
TCAGATAAGATCGGCTGAAACTCCGATACTACCCTAATCGGCAACCAGAAGGCAGGTTAGAGATTGGTATTCTAAGCACGACTTAATAGATCAAACTCAA[C/A]
TGATGCAGCATTAAGTATGAAAAGAAGAACAATATCTAGACAATCAAGTCGCTGGAAGTTTCATAGAGTGGTAGATATCTTACATAATCTAAATCAACGT
ACGTTGATTTAGATTATGTAAGATATCTACCACTCTATGAAACTTCCAGCGACTTGATTGTCTAGATATTGTTCTTCTTTTCATACTTAATGCTGCATCA[G/T]
TTGAGTTTGATCTATTAAGTCGTGCTTAGAATACCAATCTCTAACCTGCCTTCTGGTTGCCGATTAGGGTAGTATCGGAGTTTCAGCCGATCTTATCTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 9.00% | 3.20% | 0.00% | NA |
| All Indica | 2759 | 92.40% | 4.50% | 3.15% | 0.00% | NA |
| All Japonica | 1512 | 90.90% | 8.60% | 0.53% | 0.00% | NA |
| Aus | 269 | 22.30% | 58.40% | 19.33% | 0.00% | NA |
| Indica I | 595 | 94.10% | 2.40% | 3.53% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.80% | 7.30% | 2.85% | 0.00% | NA |
| Indica Intermediate | 786 | 89.60% | 5.30% | 5.09% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.40% | 24.00% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 3.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315359335 | C -> A | LOC_Os03g26890.1 | upstream_gene_variant ; 2472.0bp to feature; MODIFIER | silent_mutation | Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136 | N | N | N | N |
| vg0315359335 | C -> A | LOC_Os03g26900.1 | upstream_gene_variant ; 738.0bp to feature; MODIFIER | silent_mutation | Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136 | N | N | N | N |
| vg0315359335 | C -> A | LOC_Os03g26900-LOC_Os03g26910 | intergenic_region ; MODIFIER | silent_mutation | Average:26.808; most accessible tissue: Minghui63 flag leaf, score: 38.136 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315359335 | 8.25E-06 | NA | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | NA | 4.38E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | NA | 3.16E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | NA | 3.51E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | NA | 7.60E-06 | mr1444 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | NA | 9.02E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | NA | 9.05E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | NA | 4.17E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | 3.72E-06 | 1.46E-07 | mr1948 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315359335 | 5.30E-06 | 5.30E-06 | mr1314_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |