\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315356844:

Variant ID: vg0315356844 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15356844
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGGCATCAGTCAAACTCAAGCTGTAACACTTATTTCTCATCTCCCTGAATCTCTGAATATACTCATGTACTGGCTCATCATGCTTTTGCTTGATCAAC[A/G]
TCAGATCAGACAATTTCATCTCATGAATCCCACTCTAGAAATAGCTATGAAACTGCTTTTCTAAATCAGCCCAGCTGTTAATTGATCCATATGGTAAAGA

Reverse complement sequence

TCTTTACCATATGGATCAATTAACAGCTGGGCTGATTTAGAAAAGCAGTTTCATAGCTATTTCTAGAGTGGGATTCATGAGATGAAATTGTCTGATCTGA[T/C]
GTTGATCAAGCAAAAGCATGATGAGCCAGTACATGAGTATATTCAGAGATTCAGGGAGATGAGAAATAAGTGTTACAGCTTGAGTTTGACTGATGCCCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.70% 20.00% 4.61% 54.63% NA
All Indica  2759 11.00% 4.70% 3.77% 80.54% NA
All Japonica  1512 19.40% 52.80% 7.08% 20.77% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 4.20% 3.90% 2.52% 89.41% NA
Indica II  465 9.20% 0.40% 4.52% 85.81% NA
Indica III  913 15.70% 7.10% 4.71% 72.51% NA
Indica Intermediate  786 11.80% 5.00% 3.18% 80.03% NA
Temperate Japonica  767 8.50% 84.40% 1.69% 5.48% NA
Tropical Japonica  504 36.30% 17.30% 9.52% 36.90% NA
Japonica Intermediate  241 18.70% 26.60% 19.09% 35.68% NA
VI/Aromatic  96 90.60% 1.00% 2.08% 6.25% NA
Intermediate  90 32.20% 20.00% 5.56% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315356844 A -> DEL LOC_Os03g26890.1 N frameshift_variant Average:33.848; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg0315356844 A -> G LOC_Os03g26890.1 missense_variant ; p.Met7Thr; MODERATE nonsynonymous_codon ; M7T Average:33.848; most accessible tissue: Minghui63 flag leaf, score: 64.867 benign -0.708 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315356844 3.03E-06 NA mr1139 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 4.46E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 6.73E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 2.34E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 6.15E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 1.84E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 1.32E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 5.49E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 2.83E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315356844 NA 3.91E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251