\
| Variant ID: vg0315353447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15353447 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
CAAAGAATAAAGTCCATGGCACAATTTCAACCGAGCCGATTGAATCATCACCATGTTCCACAATAAAATCGGCTATAGCTTGTCCCTTAATCGCCTTCAG[T/C]
GACTCATACCGAAGATCAAACTCAGTTAAGGAAAATATCCACTTTTCAACCCTTCCTTTCAATATTGGAGCCGATAACATGTATTTGACAACATCGGCCT
AGGCCGATGTTGTCAAATACATGTTATCGGCTCCAATATTGAAAGGAAGGGTTGAAAAGTGGATATTTTCCTTAACTGAGTTTGATCTTCGGTATGAGTC[A/G]
CTGAAGGCGATTAAGGGACAAGCTATAGCCGATTTTATTGTGGAACATGGTGATGATTCAATCGGCTCGGTTGAAATTGTGCCATGGACTTTATTCTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.00% | 17.60% | 0.85% | 0.55% | NA |
| All Indica | 2759 | 97.00% | 0.90% | 1.23% | 0.94% | NA |
| All Japonica | 1512 | 47.00% | 52.70% | 0.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.30% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.80% | 1.90% | 2.08% | 2.30% | NA |
| Indica Intermediate | 786 | 97.70% | 0.40% | 1.27% | 0.64% | NA |
| Temperate Japonica | 767 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.90% | 17.30% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 26.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315353447 | T -> C | LOC_Os03g26890.1 | synonymous_variant ; p.Ser894Ser; LOW | synonymous_codon | Average:36.8; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| vg0315353447 | T -> DEL | LOC_Os03g26890.1 | N | frameshift_variant | Average:36.8; most accessible tissue: Minghui63 flag leaf, score: 53.617 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315353447 | 2.23E-06 | 2.74E-21 | mr1155 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 4.46E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 6.73E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 2.19E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 4.44E-13 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 6.15E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 2.48E-14 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 1.32E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 7.89E-11 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 5.49E-07 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 1.60E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 2.83E-09 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 3.36E-12 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315353447 | NA | 3.91E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |