\
| Variant ID: vg0315349460 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15349460 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 313. )
GGGAGAAACATCCAAGTCTCCTATGAATTTTATCACCCAATGAGCTCGGCCAGACAACTTGGATTGGGCCAACTCCCAATCGGCTTATTCTTTGCCGACA[A/C]
GATTCAGTGCCGAGGAGAAATCACATCCACTCTAATGATGGATCGGCTACTTAACCTACCAGGACCCTCTCTGGGCAGTATTGATAATATTAAGTTGGCA
TGCCAACTTAATATTATCAATACTGCCCAGAGAGGGTCCTGGTAGGTTAAGTAGCCGATCCATCATTAGAGTGGATGTGATTTCTCCTCGGCACTGAATC[T/G]
TGTCGGCAAAGAATAAGCCGATTGGGAGTTGGCCCAATCCAAGTTGTCTGGCCGAGCTCATTGGGTGATAAAATTCATAGGAGACTTGGATGTTTCTCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.10% | 0.23% | 0.63% | NA |
| All Indica | 2759 | 95.90% | 2.80% | 0.29% | 1.01% | NA |
| All Japonica | 1512 | 91.20% | 8.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 4.70% | 0.65% | 1.29% | NA |
| Indica III | 913 | 91.80% | 5.40% | 0.55% | 2.30% | NA |
| Indica Intermediate | 786 | 99.10% | 0.80% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 91.80% | 8.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 78.10% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315349460 | A -> C | LOC_Os03g26880.1 | missense_variant ; p.Lys329Thr; MODERATE | nonsynonymous_codon ; K329T | Average:38.343; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | possibly damaging |
1.525 |
DELETERIOUS | 0.01 |
| vg0315349460 | A -> DEL | LOC_Os03g26880.1 | N | frameshift_variant | Average:38.343; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315349460 | NA | 1.62E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315349460 | 5.85E-06 | 2.98E-06 | mr1227_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315349460 | NA | 3.61E-07 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315349460 | NA | 3.72E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315349460 | 3.53E-07 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315349460 | NA | 6.20E-07 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315349460 | NA | 8.72E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |