Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315348932:

Variant ID: vg0315348932 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15348932
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGTAGCCGAAGCCTTAGAATCAAAGAAAGAATTTCCATTAGGCAAGATCCTCCTCGGCTACTTATACCAAACATTGAACAACGCATCGGCCAAAATAG[C/T]
CGTTGGCTCAGTAGTTGGTGCAGGTGGACCATGGTGGCTGCTGCAAACCTGGTTGAACCTGATGGTTAAGAAAGTTGTCAATCGACCGCCTATGACAGAA

Reverse complement sequence

TTCTGTCATAGGCGGTCGATTGACAACTTTCTTAACCATCAGGTTCAACCAGGTTTGCAGCAGCCACCATGGTCCACCTGCACCAACTACTGAGCCAACG[G/A]
CTATTTTGGCCGATGCGTTGTTCAATGTTTGGTATAAGTAGCCGAGGAGGATCTTGCCTAATGGAAATTCTTTCTTTGATTCTAAGGCTTCGGCTACAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	9.00%	3.00%	4.78%	NA
All Indica	2759	91.40%	2.40%	2.10%	4.06%	NA
All Japonica	1512	82.30%	13.80%	1.19%	2.71%	NA
Aus	269	2.20%	48.70%	22.68%	26.39%	NA
Indica I	595	93.80%	1.00%	1.51%	3.70%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	88.70%	2.00%	2.74%	6.57%	NA
Indica Intermediate	786	87.80%	5.30%	3.05%	3.82%	NA
Temperate Japonica	767	96.50%	3.50%	0.00%	0.00%	NA
Tropical Japonica	504	68.10%	20.60%	3.57%	7.74%	NA
Japonica Intermediate	241	67.20%	32.00%	0.00%	0.83%	NA
VI/Aromatic	96	92.70%	5.20%	2.08%	0.00%	NA
Intermediate	90	78.90%	15.60%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315348932	C -> T	LOC_Os03g26880.1	missense_variant ; p.Ala153Val; MODERATE	nonsynonymous_codon ; A153V	Average:40.926; most accessible tissue: Minghui63 flag leaf, score: 59.244	benign	1.126	TOLERATED	0.07
vg0315348932	C -> DEL	LOC_Os03g26880.1	N	frameshift_variant	Average:40.926; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315348932	NA	3.79E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	4.25E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	5.62E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	1.45E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	3.46E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	1.13E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	3.51E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	8.32E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	5.83E-07	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	3.44E-06	mr1339	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	6.45E-08	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	3.27E-08	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	4.16E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	3.94E-09	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	5.90E-07	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	6.41E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	4.39E-06	mr1444	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	1.98E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	1.22E-06	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	5.48E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	1.20E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	2.73E-10	mr1669	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	9.35E-14	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	8.72E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	3.52E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	2.12E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	1.32E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	9.45E-08	mr1876	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	4.30E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315348932	NA	3.20E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251