Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315319895:

Variant ID: vg0315319895 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15319895
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTGGCATTAGGGCCCCTTACCTTATTCCCCACGTGAGTCACTGTCTTAACAAGTAGACCCACACTAACTCAATCGGGTTGACCACACTGAACTTGTCAC[A/G]
TCAACCAAAATCAGAGACAATATTGCTCTTTGACCTTAGGTACTTTGGTATTACAAAGTTGAGAGACAGGTTATATTTGATATTGTGATTCAAGGACGTT

Reverse complement sequence

AACGTCCTTGAATCACAATATCAAATATAACCTGTCTCTCAACTTTGTAATACCAAAGTACCTAAGGTCAAAGAGCAATATTGTCTCTGATTTTGGTTGA[T/C]
GTGACAAGTTCAGTGTGGTCAACCCGATTGAGTTAGTGTGGGTCTACTTGTTAAGACAGTGACTCACGTGGGGAATAAGGTAAGGGGCCCTAATGCCACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.50%	17.50%	0.00%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	46.80%	53.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	9.40%	90.60%	0.00%	0.00%	NA
Tropical Japonica	504	85.50%	14.50%	0.00%	0.00%	NA
Japonica Intermediate	241	84.60%	15.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315319895	A -> G	LOC_Os03g26840.1	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:75.536; most accessible tissue: Minghui63 root, score: 85.77	N	N	N	N
vg0315319895	A -> G	LOC_Os03g26850.1	downstream_gene_variant ; 552.0bp to feature; MODIFIER	silent_mutation	Average:75.536; most accessible tissue: Minghui63 root, score: 85.77	N	N	N	N
vg0315319895	A -> G	LOC_Os03g26860.1	downstream_gene_variant ; 1967.0bp to feature; MODIFIER	silent_mutation	Average:75.536; most accessible tissue: Minghui63 root, score: 85.77	N	N	N	N
vg0315319895	A -> G	LOC_Os03g26850-LOC_Os03g26860	intergenic_region ; MODIFIER	silent_mutation	Average:75.536; most accessible tissue: Minghui63 root, score: 85.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315319895	NA	4.39E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	7.59E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.45E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	6.19E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	3.85E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.55E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	2.80E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	4.87E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	4.06E-23	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	4.98E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	7.79E-08	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.22E-23	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.89E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.63E-35	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.20E-12	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	2.02E-29	mr1584_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	4.10E-11	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.62E-07	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	6.90E-06	3.80E-16	mr1853_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.42E-08	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319895	NA	1.71E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251