\
| Variant ID: vg0315319561 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 15319561 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCTTATTTCTCATTTTGATTTACTTTTACCTTACCTTTTTATTACTGTTAAACTTATAGTTGTGTGTCTTATGACAGAAGCAGGAGATGTAATCCATTT[T/C]
CATTATCTAAAAATGGTGGCCTCGCCCCTGACCTGTTTACTAAGCCCAAAAGTATGCCATTCGCAGTGGATACACTTGCATACGTTGACGTTGAGTTTGA
TCAAACTCAACGTCAACGTATGCAAGTGTATCCACTGCGAATGGCATACTTTTGGGCTTAGTAAACAGGTCAGGGGCGAGGCCACCATTTTTAGATAATG[A/G]
AAATGGATTACATCTCCTGCTTCTGTCATAAGACACACAACTATAAGTTTAACAGTAATAAAAAGGTAAGGTAAAAGTAAATCAAAATGAGAAATAAGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.80% | 17.60% | 0.08% | 15.55% | NA |
| All Indica | 2759 | 88.40% | 0.30% | 0.00% | 11.31% | NA |
| All Japonica | 1512 | 37.50% | 53.20% | 0.00% | 9.33% | NA |
| Aus | 269 | 3.00% | 0.40% | 1.49% | 95.17% | NA |
| Indica I | 595 | 93.30% | 0.30% | 0.00% | 6.39% | NA |
| Indica II | 465 | 93.80% | 0.40% | 0.00% | 5.81% | NA |
| Indica III | 913 | 83.50% | 0.20% | 0.00% | 16.32% | NA |
| Indica Intermediate | 786 | 87.20% | 0.40% | 0.00% | 12.47% | NA |
| Temperate Japonica | 767 | 9.50% | 90.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 59.10% | 14.50% | 0.00% | 26.39% | NA |
| Japonica Intermediate | 241 | 81.30% | 15.40% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 91.70% | 1.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 62.20% | 16.70% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0315319561 | T -> C | LOC_Os03g26840.1 | upstream_gene_variant ; 3028.0bp to feature; MODIFIER | silent_mutation | Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0315319561 | T -> C | LOC_Os03g26850.1 | downstream_gene_variant ; 218.0bp to feature; MODIFIER | silent_mutation | Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0315319561 | T -> C | LOC_Os03g26860.1 | downstream_gene_variant ; 2301.0bp to feature; MODIFIER | silent_mutation | Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0315319561 | T -> C | LOC_Os03g26850-LOC_Os03g26860 | intergenic_region ; MODIFIER | silent_mutation | Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0315319561 | T -> DEL | N | N | silent_mutation | Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0315319561 | NA | 4.39E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 7.59E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 1.48E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 6.19E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 3.85E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 1.68E-13 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 2.80E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 9.29E-22 | mr1308_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 4.98E-08 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 7.79E-08 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 8.78E-23 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 1.89E-10 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 3.19E-34 | mr1368_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 1.20E-12 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 2.52E-28 | mr1584_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 4.10E-11 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 3.81E-15 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 1.42E-08 | mr1853_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0315319561 | NA | 8.84E-18 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |