Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315319561:

Variant ID: vg0315319561 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 15319561
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTTATTTCTCATTTTGATTTACTTTTACCTTACCTTTTTATTACTGTTAAACTTATAGTTGTGTGTCTTATGACAGAAGCAGGAGATGTAATCCATTT[T/C]
CATTATCTAAAAATGGTGGCCTCGCCCCTGACCTGTTTACTAAGCCCAAAAGTATGCCATTCGCAGTGGATACACTTGCATACGTTGACGTTGAGTTTGA

Reverse complement sequence

TCAAACTCAACGTCAACGTATGCAAGTGTATCCACTGCGAATGGCATACTTTTGGGCTTAGTAAACAGGTCAGGGGCGAGGCCACCATTTTTAGATAATG[A/G]
AAATGGATTACATCTCCTGCTTCTGTCATAAGACACACAACTATAAGTTTAACAGTAATAAAAAGGTAAGGTAAAAGTAAATCAAAATGAGAAATAAGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.80%	17.60%	0.08%	15.55%	NA
All Indica	2759	88.40%	0.30%	0.00%	11.31%	NA
All Japonica	1512	37.50%	53.20%	0.00%	9.33%	NA
Aus	269	3.00%	0.40%	1.49%	95.17%	NA
Indica I	595	93.30%	0.30%	0.00%	6.39%	NA
Indica II	465	93.80%	0.40%	0.00%	5.81%	NA
Indica III	913	83.50%	0.20%	0.00%	16.32%	NA
Indica Intermediate	786	87.20%	0.40%	0.00%	12.47%	NA
Temperate Japonica	767	9.50%	90.50%	0.00%	0.00%	NA
Tropical Japonica	504	59.10%	14.50%	0.00%	26.39%	NA
Japonica Intermediate	241	81.30%	15.40%	0.00%	3.32%	NA
VI/Aromatic	96	91.70%	1.00%	0.00%	7.29%	NA
Intermediate	90	62.20%	16.70%	0.00%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0315319561	T -> C	LOC_Os03g26840.1	upstream_gene_variant ; 3028.0bp to feature; MODIFIER	silent_mutation	Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0315319561	T -> C	LOC_Os03g26850.1	downstream_gene_variant ; 218.0bp to feature; MODIFIER	silent_mutation	Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0315319561	T -> C	LOC_Os03g26860.1	downstream_gene_variant ; 2301.0bp to feature; MODIFIER	silent_mutation	Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0315319561	T -> C	LOC_Os03g26850-LOC_Os03g26860	intergenic_region ; MODIFIER	silent_mutation	Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0315319561	T -> DEL	N	N	silent_mutation	Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0315319561	NA	4.39E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	7.59E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	1.48E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	6.19E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	3.85E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	1.68E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	2.80E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	9.29E-22	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	4.98E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	7.79E-08	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	8.78E-23	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	1.89E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	3.19E-34	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	1.20E-12	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	2.52E-28	mr1584_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	4.10E-11	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	3.81E-15	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	1.42E-08	mr1853_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561	NA	8.84E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251