\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315319561:

Variant ID: vg0315319561 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15319561
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTTATTTCTCATTTTGATTTACTTTTACCTTACCTTTTTATTACTGTTAAACTTATAGTTGTGTGTCTTATGACAGAAGCAGGAGATGTAATCCATTT[T/C]
CATTATCTAAAAATGGTGGCCTCGCCCCTGACCTGTTTACTAAGCCCAAAAGTATGCCATTCGCAGTGGATACACTTGCATACGTTGACGTTGAGTTTGA

Reverse complement sequence

TCAAACTCAACGTCAACGTATGCAAGTGTATCCACTGCGAATGGCATACTTTTGGGCTTAGTAAACAGGTCAGGGGCGAGGCCACCATTTTTAGATAATG[A/G]
AAATGGATTACATCTCCTGCTTCTGTCATAAGACACACAACTATAAGTTTAACAGTAATAAAAAGGTAAGGTAAAAGTAAATCAAAATGAGAAATAAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 17.60% 0.08% 15.55% NA
All Indica  2759 88.40% 0.30% 0.00% 11.31% NA
All Japonica  1512 37.50% 53.20% 0.00% 9.33% NA
Aus  269 3.00% 0.40% 1.49% 95.17% NA
Indica I  595 93.30% 0.30% 0.00% 6.39% NA
Indica II  465 93.80% 0.40% 0.00% 5.81% NA
Indica III  913 83.50% 0.20% 0.00% 16.32% NA
Indica Intermediate  786 87.20% 0.40% 0.00% 12.47% NA
Temperate Japonica  767 9.50% 90.50% 0.00% 0.00% NA
Tropical Japonica  504 59.10% 14.50% 0.00% 26.39% NA
Japonica Intermediate  241 81.30% 15.40% 0.00% 3.32% NA
VI/Aromatic  96 91.70% 1.00% 0.00% 7.29% NA
Intermediate  90 62.20% 16.70% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315319561 T -> C LOC_Os03g26840.1 upstream_gene_variant ; 3028.0bp to feature; MODIFIER silent_mutation Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0315319561 T -> C LOC_Os03g26850.1 downstream_gene_variant ; 218.0bp to feature; MODIFIER silent_mutation Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0315319561 T -> C LOC_Os03g26860.1 downstream_gene_variant ; 2301.0bp to feature; MODIFIER silent_mutation Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0315319561 T -> C LOC_Os03g26850-LOC_Os03g26860 intergenic_region ; MODIFIER silent_mutation Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0315319561 T -> DEL N N silent_mutation Average:54.75; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315319561 NA 4.39E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 7.59E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 1.48E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 6.19E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 3.85E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 1.68E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 2.80E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 9.29E-22 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 4.98E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 7.79E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 8.78E-23 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 1.89E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 3.19E-34 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 1.20E-12 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 2.52E-28 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 4.10E-11 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 3.81E-15 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 1.42E-08 mr1853_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315319561 NA 8.84E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251