\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315318850:

Variant ID: vg0315318850 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15318850
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAAGTATAAAGTATATATATACTCTTTTCTATAATTCTTAGGTATACATATGAATACCTATGAATCATGGTGGGCTCGCGATCATAAACTGTAATGTTT[G/A]
GATAAAAAGAGAATTCTGTGGGACTTGAAAATTCCACTAAAGATCAAGGTCTTTATGTGGTTTCTTCACAAGAAAGTAATTCTAACGAAAGATAACCTGG

Reverse complement sequence

CCAGGTTATCTTTCGTTAGAATTACTTTCTTGTGAAGAAACCACATAAAGACCTTGATCTTTAGTGGAATTTTCAAGTCCCACAGAATTCTCTTTTTATC[C/T]
AAACATTACAGTTTATGATCGCGAGCCCACCATGATTCATAGGTATTCATATGTATACCTAAGAATTATAGAAAAGAGTATATATATACTTTATACTTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 25.50% 4.59% 8.48% NA
All Indica  2759 86.90% 4.70% 5.00% 3.37% NA
All Japonica  1512 29.20% 61.80% 0.07% 8.93% NA
Aus  269 1.90% 13.00% 27.14% 57.99% NA
Indica I  595 93.30% 1.00% 3.53% 2.18% NA
Indica II  465 93.10% 3.20% 0.00% 3.66% NA
Indica III  913 80.10% 9.30% 8.43% 2.19% NA
Indica Intermediate  786 86.40% 3.10% 5.09% 5.47% NA
Temperate Japonica  767 7.40% 92.60% 0.00% 0.00% NA
Tropical Japonica  504 50.00% 24.60% 0.20% 25.20% NA
Japonica Intermediate  241 55.20% 41.50% 0.00% 3.32% NA
VI/Aromatic  96 9.40% 84.40% 1.04% 5.21% NA
Intermediate  90 54.40% 27.80% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315318850 G -> A LOC_Os03g26840.1 upstream_gene_variant ; 2317.0bp to feature; MODIFIER silent_mutation Average:39.846; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0315318850 G -> A LOC_Os03g26860.1 downstream_gene_variant ; 3012.0bp to feature; MODIFIER silent_mutation Average:39.846; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0315318850 G -> A LOC_Os03g26850.1 intron_variant ; MODIFIER silent_mutation Average:39.846; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0315318850 G -> DEL N N silent_mutation Average:39.846; most accessible tissue: Minghui63 root, score: 63.915 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315318850 NA 5.96E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 2.01E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 1.20E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 6.13E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 8.94E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 6.58E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 7.92E-14 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 7.16E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 4.47E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 1.74E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 1.40E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 6.19E-07 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 2.28E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 9.43E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 4.56E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 1.95E-08 9.66E-10 mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 1.48E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 1.95E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 2.48E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 1.97E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 6.19E-07 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 2.47E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 7.58E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 3.68E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 5.05E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 5.71E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 1.20E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 8.40E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 7.40E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 3.33E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 6.85E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 5.86E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 2.30E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318850 NA 1.87E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251