\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0315318288:

Variant ID: vg0315318288 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 15318288
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACCCGTCTGCTCCCCACGCGCTGCCGCCCACTGCCCGTCCACACGCTGCCGTGCTGTCGTGCGCCCGTGTGCGCTTTGCGCCCAAGAGAGAGAAGGGG[A/G]
AAAGAGGGAAGAAGGTATGACAGGTAGGTTCCACCATTTTATTCAAAGAAAAATACTGACTAGATTGCCGCATGTACGCACGTAAGACAAAATAACTCTG

Reverse complement sequence

CAGAGTTATTTTGTCTTACGTGCGTACATGCGGCAATCTAGTCAGTATTTTTCTTTGAATAAAATGGTGGAACCTACCTGTCATACCTTCTTCCCTCTTT[T/C]
CCCCTTCTCTCTCTTGGGCGCAAAGCGCACACGGGCGCACGACAGCACGGCAGCGTGTGGACGGGCAGTGGGCGGCAGCGCGTGGGGAGCAGACGGGTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 17.10% 0.32% 15.68% NA
All Indica  2759 88.30% 0.30% 0.11% 11.31% NA
All Japonica  1512 38.00% 52.00% 0.73% 9.33% NA
Aus  269 2.20% 0.00% 0.37% 97.40% NA
Indica I  595 93.30% 0.30% 0.17% 6.22% NA
Indica II  465 93.80% 0.20% 0.22% 5.81% NA
Indica III  913 83.40% 0.20% 0.11% 16.32% NA
Indica Intermediate  786 87.00% 0.40% 0.00% 12.60% NA
Temperate Japonica  767 10.40% 88.30% 1.30% 0.00% NA
Tropical Japonica  504 59.10% 14.50% 0.00% 26.39% NA
Japonica Intermediate  241 81.30% 14.90% 0.41% 3.32% NA
VI/Aromatic  96 91.70% 1.00% 0.00% 7.29% NA
Intermediate  90 62.20% 16.70% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0315318288 A -> DEL LOC_Os03g26850.1 N frameshift_variant Average:36.237; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0315318288 A -> G LOC_Os03g26850.1 missense_variant ; p.Lys46Glu; MODERATE nonsynonymous_codon ; K46G Average:36.237; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 unknown unknown DELETERIOUS 0.00
vg0315318288 A -> G LOC_Os03g26850.1 missense_variant ; p.Lys46Glu; MODERATE nonsynonymous_codon ; K46E Average:36.237; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0315318288 NA 2.12E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 2.25E-09 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 3.44E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 7.78E-17 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 1.19E-17 mr1169 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 1.20E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 6.00E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 1.69E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 6.53E-06 5.53E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 4.34E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 3.20E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 2.94E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 2.49E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 1.30E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 4.32E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 1.51E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 2.44E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 1.22E-06 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 5.51E-06 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0315318288 NA 2.77E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251